Cart 33 Product Products 4 580,68 € (empty)
-
1 x RGS1...259,07 € -
1 x FAM163A-fa...113,40 € -
1 x TMPO-thymo...121,50 € -
1 x RASSF8-Ras...121,50 € -
-
1 x TSPAN12-te...121,50 € -
1 x PFDN2-pref...113,40 € -
1 x GPR52-G...121,50 € -
1 x CTSG-cathe...113,40 € -
-
1 x RPL7L1-rib...113,40 € -
1 x SLP-76...259,07 € -
1 x COX11-COX1...121,50 € -
1 x C12orf10-c...121,50 € -
1 x VDAC3-volt...121,50 € -
1 x Septin 2...259,07 € -
-
-
1 x PLD4-phosp...121,50 € -
1 x CXCL13-che...113,40 € -
1 x COL20A1-co...113,40 € -
1 x LRRC14-leu...121,50 € -
1 x PPAP2B-pho...121,50 € -
1 x MXD3-MAX...113,40 € -
1 x VASP-vasod...121,50 € -
-
-
-
1 x C9orf61-ch...121,50 € -
-
1 x NIPSNAP3A-...113,40 € -
1 x FICD-FIC...121,50 € -
1 x KDELR3-KDE...113,40 €
No products
To be determined Shipping
4 580,68 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 33 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 580,68 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 580,68 €
Data sheet of TIMP1-TIMP metallopeptidase inhibitor 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TIMP1-TIMP metallopeptidase inhibitor 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000866 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TIMP1 |
| Origin species: | Human |
| Product name: | TIMP1-TIMP metallopeptidase inhibitor 1 Gene |
| Size: | 2ug |
| Accessions: | BC000866 |
| Gene id: | 7076 |
| Gene description: | TIMP metallopeptidase inhibitor 1 |
| Synonyms: | CLGI; EPA; EPO; HCI; TIMP; metalloproteinase inhibitor 1; collagenase inhibitor; erythroid potentiating activity; fibroblast collagenase inhibitor; tissue inhibitor of metalloproteinases 1; TIMP metallopeptidase inhibitor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccccctttgagcccctggcttctggcatcctgttgttgctgtggctgatagcccccagcagggcctgcacctgtgtcccaccccacccacagacggccttctgcaattccgacctcgtcatcagggccaagttcgtggggacaccagaagtcaaccagaccaccttataccagcgttatgagatcaagatgaccaagatgtataaagggttccaagccttaggggatgccgctgacatccggttcgtctacacccccgccatggagagtgtctgcggatacttccacaggtcccacaaccgcagcgaggagtttctcattgctggaaaactgcaggatggactcttgcacatcactacctgcagtttcgtggctccctggaacagcctgagcttagctcagcgccggggcttcaccaagacctacactgttggctgtgaggaatgcacagtgtttccctgtttatccatcccctgcaaactgcagagtggcactcattgcttgtggacggaccagctcctccaaggctctgaaaagggcttccagtcccgtcaccttgcctgcctgcctcgggagccagggctgtgcacctggcagtccctgcggtcccagatagcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RAB38, member RAS oncogene family - RAB2A, member RAS oncogene family - RAB39, member RAS oncogene family - RAB4A, member RAS oncogene family |