Cart 9 Product Products 1 057,17 € (empty)
-
1 x RSL1D1-rib...121,50 € -
1 x GOSR2-golg...113,40 € -
1 x ICAM2-inte...121,50 € -
1 x GLIPR2-GLI...113,40 € -
1 x C9orf82-ch...121,50 € -
1 x PAPD4-PAP...121,50 € -
1 x SOX7-SRY...121,50 € -
-
1 x HIST1H2AM-...113,40 €
No products
To be determined Shipping
1 057,17 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 9 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 057,17 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 057,17 €
Data sheet of CLDN11-claudin 11 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CLDN11-claudin 11 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013577 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CLDN11 |
| Origin species: | Human |
| Product name: | CLDN11-claudin 11 Gene |
| Size: | 2ug |
| Accessions: | BC013577 |
| Gene id: | 5010 |
| Gene description: | claudin 11 |
| Synonyms: | OSP; OTM; claudin-11; oligodendrocyte transmembrane protein; oligodendrocyte-specific protein; claudin 11 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtggccacgtgcctgcaggtggtgggcttcgtcacgagcttcgtgggctggatcggggtcatcgtgaccacctccaccaatgactgggtggtgacctgcggctacaccatccccacctgccgcaagctggatgagctgggctccaaggggctgtgggccgactgcgtcatggccacggggctgtaccactgcaagcccctggtggacatcctcatcctgccgggctacgtgcaggcctgccgcgccctgatgattgctgcctcggtcctgggtctgccggccattttactgctgctgactgttcttccctgcatccggatgggccaggagcccggtgtggctaagtacaggcgggcccagctggctggtgttttgctcattctgctggctctctgcgcccttgttgccaccatctggttccctgtgtgcgcccaccgtgagaccaccatcgtgagctttggctactccctgtatgcaggctggattggtgctgtgctgtgcctcgtgggtggctgtgtcatcctctgctgcgctggagatgcccaggcctttggtgaaaaccgtttctactacactgcgggctctagctccccgactcatgcgaagagtgcccacgtataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - endothelin 1 - KIAA0907 - homeobox B9 - amphiregulin |