> >>BTG4-B-cell translocation gene 4 Gene
BTG4-B-cell translocation gene 4 Gene View larger

BTG4-B-cell translocation gene 4 Gene

PTXBC031045

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of BTG4-B-cell translocation gene 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about BTG4-B-cell translocation gene 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC031045
Product type: DNA & cDNA
Ncbi symbol: BTG4
Origin species: Human
Product name: BTG4-B-cell translocation gene 4 Gene
Size: 2ug
Accessions: BC031045
Gene id: 54766
Gene description: B-cell translocation gene 4
Synonyms: protein BTG4; APRO3; PC3B; B-cell translocation gene 4; BTG family member 4; protein PC3b; BTG anti-proliferation factor 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagagatgaaattgcaacaacagttttctttgtcacaagattggtgaaaaaacatgataaactaagtaaacagcaaatagaagactttgcagaaaagctgatgacgatcttgtttgaaacatacagaagtcactggcactctgattgcccttctaaagggcaagccttcaggtgcatcaggataaacaacaatcagaataaagatcccattctagaaagggcatgtgtggaaagtaatgtagatttttctcacctgggacttccgaaggagatgaccatatgggtagatccctttgaagtatgctgtaggtatggtgagaaaaaccatccatttacagttgcttcttttaaaggcagatgggaggaatgggaactatatcaacaaatcagttatgcagttagtagagcctcatcagacgtttcctctggcacttcctgcgatgaagaaagttgtagcaaggaacctcgtgtcattcctaaagtcagcaatccgaagagtatttatcaggtcaagagtgttccagttcttttctatactttttttctatctaattctaaaaagaatgcactcattatgaaaacaaagaagcaaaaaaacatggaaagaacaaaactgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - clathrin, light chain (Lcb)
- myelin expression factor 2
- immunoglobulin lambda locus
- WW domain binding protein 2

Reviews

Buy BTG4-B-cell translocation gene 4 Gene now

Add to cart