Cart 20 Product Products 2 823,36 € (empty)
-
1 x TEKT4-tekt...121,50 € -
1 x ANKRD10-an...113,40 € -
1 x ANKRD12-an...121,50 € -
1 x CRYBB3-cry...113,40 € -
1 x PDPN-podop...113,40 € -
1 x DPM1-dolic...113,40 € -
1 x CLEC1B-C-t...113,40 € -
1 x ABHD1-abhy...121,50 € -
1 x AMTN-amelo...113,40 € -
1 x PALM-paral...113,40 € -
1 x APTX-aprat...113,40 € -
1 x HEL308-DNA...121,50 € -
1 x AMZ2-archa...121,50 € -
1 x ATXN3-atax...121,50 € -
1 x CDC2-cell...121,50 € -
1 x CLEC10A-C-...113,40 € -
-
1 x DC2-DC2...113,40 € -
1 x ANKRD1-ank...121,50 € -
1 x ATP5D-ATP...113,40 €
No products
To be determined Shipping
2 823,36 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 20 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 823,36 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 823,36 €
View larger 
Data sheet of SNAP25-synaptosomal-associated protein, 25kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SNAP25-synaptosomal-associated protein, 25kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010647 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SNAP25 |
| Origin species: | Human |
| Product name: | SNAP25-synaptosomal-associated protein, 25kDa Gene |
| Size: | 2ug |
| Accessions: | BC010647 |
| Gene id: | 6616 |
| Gene description: | synaptosomal-associated protein, 25kDa |
| Synonyms: | CMS18; RIC-4; RIC4; SEC9; SNAP-25; SUP; bA416N4.2; dJ1068F16.2; synaptosomal-associated protein 25; resistance to inhibitors of cholinesterase 4 homolog; synaptosomal-associated protein, 25kDa; synaptosome associated protein 25kDa; synaptosome associated protein 25 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccgaagacgcagacatgcgcaatgagctggaggagatgcagcgaagggctgaccagttggctgatgagtcgctggaaagcacccgtcgtatgctgcaactggttgaagagagtaaagatgctggtatcaggactttggttatgttggatgaacaaggagaacaactcgatcgtgtcgaagaaggcatgaaccatatcaaccaagacatgaaggaggctgagaaaaatttaaaagatttagggaaatgctgtggccttttcatatgtccttgtaacaagcttaaatcaagtgatgcttacaaaaaagcctggggcaataatcaggacggagtggtggccagccagcctgctcgtgtagtggacgaacgggagcagatggccatcagtggcggcttcatccgcagggtaacaaatgatgcccgagaaaatgaaatggatgaaaacctagagcaggtgagcggcatcatcgggaacctccgtcacatggccctggatatgggcaatgagatcgatacacagaatcgccagatcgacaggatcatggagaaggctgattccaacaaaaccagaattgatgaggccaaccaacgtgcaacaaagatgctgggaagtggttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - synaptosomal-associated protein, 23kDa - heparan sulfate 2-O-sulfotransferase 1 - mRNA turnover 4 homolog (S. cerevisiae) - peroxisomal biogenesis factor 11 gamma |