Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PUS7-pseudouridylate synthase 7 homolog (S. cerevisiae) Gene
PTXBC011396
New product
Data sheet of PUS7-pseudouridylate synthase 7 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PUS7-pseudouridylate synthase 7 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011396 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PUS7 |
| Origin species: | Human |
| Product name: | PUS7-pseudouridylate synthase 7 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC011396 |
| Gene id: | 54517 |
| Gene description: | pseudouridylate synthase 7 homolog (S. cerevisiae) |
| Synonyms: | pseudouridylate synthase 7 homolog; pseudouridylate synthase 7 (putative) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagaatatagtctctgcatttggcataatacccagaaataatcgcttaatgtatattcatagctaccaaagctatgtgtggaataacatggtaagcaagaggatagaagactatggactaaaacctgttccaggggacctcgttctcaaaggagccacagccacctatattgaggaagatgatgttaataattactctatccatgatgtggtaatgcccttgcctggtttcgatgttatctacccaaagcataaaattcaagaagcctacagggaaatgctcacagctgacaatcttgatattgacaacatgagacacaaaattcgagattattccttgtcaggggcctaccgaaagatcattattcgtcctcagaatgttagctgggaagtcgttgcatatgatgatcccaaaattccacttttcaacacagatgtggacaacctagaagggaagacaccaccagtttttgcttctgaaggcaaatacagggctctgaaaatggatttttctctacccccttctacttacgccaccatggccattcgagaagtgctaaaaatggataccagtatcaagaaccagacgcagctgaatacaacctggcttcgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromobox homolog 2 (Pc class homolog, Drosophila) - family with sequence similarity 177, member A1 - carboxymethylenebutenolidase homolog (Pseudomonas) - phosphoinositide-3-kinase interacting protein 1 |