Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
VSTM2L-V-set and transmembrane domain containing 2 like Gene
PTXBC033818
New product
Data sheet of VSTM2L-V-set and transmembrane domain containing 2 like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about VSTM2L-V-set and transmembrane domain containing 2 like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033818 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VSTM2L |
| Origin species: | Human |
| Product name: | VSTM2L-V-set and transmembrane domain containing 2 like Gene |
| Size: | 2ug |
| Accessions: | BC033818 |
| Gene id: | 128434 |
| Gene description: | V-set and transmembrane domain containing 2 like |
| Synonyms: | C20orf102; dJ1118M15.2; V-set and transmembrane domain-containing protein 2-like protein; V-set and transmembrane domain containing 2 like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggggccccgctcgccgtagcgctgggcgccctccactacctggcacttttcctgcaactcggcggcgccacgcggcccgccggccacgcgccctgggacaaccacgtctccggccacgccctgttcacagagacaccccatgacatgacagcacggacgggcgaggacgtggagatggcctgctccttccgcggcagcggctccccctcctactcgctggagatccagtggtggtatgtacggagccaccgggactggaccgacaagcaggcgtgggcctcgaaccagctaaaagcatctcagcaggaagacgcagggaaggaggcaaccaaaataagtgtggtcaaggtggtgggcagcaacatctcccacaagctgcgcctgtcccgggtgaagcccacggacgaaggttcctacgagtgccgcgtcatcgacttcagcgacggcaaggcccggcaccacaaggtcaaggcctacctgcgggtgcagccaggggagaactccgtcctgcatctgcccgaagcccctcccgccgcgcccgccccgccgccccccaagccaggcaaggagctgaggaagcgctcggtggaccaggaggcctgcagcctctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - pseudouridylate synthase 7 homolog (S. cerevisiae) - chromobox homolog 2 (Pc class homolog, Drosophila) - family with sequence similarity 177, member A1 - carboxymethylenebutenolidase homolog (Pseudomonas) |