PTXBC033818
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC033818 |
Product type: | DNA & cDNA |
Ncbi symbol: | VSTM2L |
Origin species: | Human |
Product name: | VSTM2L-V-set and transmembrane domain containing 2 like Gene |
Size: | 2ug |
Accessions: | BC033818 |
Gene id: | 128434 |
Gene description: | V-set and transmembrane domain containing 2 like |
Synonyms: | C20orf102; dJ1118M15.2; V-set and transmembrane domain-containing protein 2-like protein; V-set and transmembrane domain containing 2 like |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgggggccccgctcgccgtagcgctgggcgccctccactacctggcacttttcctgcaactcggcggcgccacgcggcccgccggccacgcgccctgggacaaccacgtctccggccacgccctgttcacagagacaccccatgacatgacagcacggacgggcgaggacgtggagatggcctgctccttccgcggcagcggctccccctcctactcgctggagatccagtggtggtatgtacggagccaccgggactggaccgacaagcaggcgtgggcctcgaaccagctaaaagcatctcagcaggaagacgcagggaaggaggcaaccaaaataagtgtggtcaaggtggtgggcagcaacatctcccacaagctgcgcctgtcccgggtgaagcccacggacgaaggttcctacgagtgccgcgtcatcgacttcagcgacggcaaggcccggcaccacaaggtcaaggcctacctgcgggtgcagccaggggagaactccgtcctgcatctgcccgaagcccctcccgccgcgcccgccccgccgccccccaagccaggcaaggagctgaggaagcgctcggtggaccaggaggcctgcagcctctag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - pseudouridylate synthase 7 homolog (S. cerevisiae) - chromobox homolog 2 (Pc class homolog, Drosophila) - family with sequence similarity 177, member A1 - carboxymethylenebutenolidase homolog (Pseudomonas) |