> >>RPS5-ribosomal protein S5 Gene
RPS5-ribosomal protein S5 Gene View larger

RPS5-ribosomal protein S5 Gene

PTXBC015405

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of RPS5-ribosomal protein S5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPS5-ribosomal protein S5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015405
Product type: DNA & cDNA
Ncbi symbol: RPS5
Origin species: Human
Product name: RPS5-ribosomal protein S5 Gene
Size: 2ug
Accessions: BC015405
Gene id: 6193
Gene description: ribosomal protein S5
Synonyms: 40S ribosomal protein S5; ribosomal protein S5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccgagtgggagacagcagcaccagcggtggcagagaccccagacatcaagctctttgggaagtggagcaccgatgatgtgcagatcaatgacatttccctgcaggattacattgcagtgaaggagaagtatgccaagtacctgcctcacagtgcagggcggtatgccgccaaacgcttccgcaaagctcagtgtcccattgtggagcgcctcactaactccatgatgatgcacggccgcaacaacggcaagaagctcatgactgtgcgcatcgtcaagcatgccttcgagatcatacacctgctcacaggcgagaaccctctgcaggtcctggtgaacgccatcatcaacagtggtccccgggaggactccacacgcattgggcgcgccgggactgtgagacgacaggctgtggatgtgtcccccctgcgccgtgtgaaccaggccatctggctgctgtgcacaggcgctcgtgaggctgccttccggaacattaagaccattgctgagtgcctggcagatgagctcatcaatgctgccaagggctcctcgaactcctatgccattaagaagaaggacgagctggagcgtgtggccaagtccaaccgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Coenzyme A synthase
- ribosomal protein L3
- carbonyl reductase 4
- ribosomal protein S3

Reviews

Buy RPS5-ribosomal protein S5 Gene now

Add to cart