Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of TM4SF1-transmembrane 4 L six family member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TM4SF1-transmembrane 4 L six family member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008442 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TM4SF1 |
| Origin species: | Human |
| Product name: | TM4SF1-transmembrane 4 L six family member 1 Gene |
| Size: | 2ug |
| Accessions: | BC008442 |
| Gene id: | 4071 |
| Gene description: | transmembrane 4 L six family member 1 |
| Synonyms: | H-L6; M3S1; TAAL6; transmembrane 4 L6 family member 1; membrane component, chromosome 3, surface marker 1; transmembrane 4 superfamily member 1; tumor-associated antigen L6; transmembrane 4 L six family member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgctatgggaagtgtgcacgatgcatcggacattctctggtggggctcgccctcctgtgcatcgcggctaatattttgctttactttcccaatggggaaacaaagtatgcctccgaaaaccacctcagccgcttcgtgtggttcttttctggcatcgtaggaggtggcctgctgatgctcctgccagcatttgtcttcattgggctggaacaggatgactgctgtggctgctgtggccatgaaaactgtggcaaacgatgtgcgatgctttcttctgtattggctgctctcattggaattgcaggatctggctactgtgtcattgtggcagcccttggcttagcagaaggaccactatgtcttgattccctcggccagtggaactacacctttgccagcaccgagggccagtaccttctggatacctccacatggtccgagtgcactgaacccaagcacattgtggaatggaatgtatctctgttttctatcctcttggctcttggtggaattgaattcatcttgtgtcttattcaagtaataaatggagtgcttggaggcatatgtggcttttgctgctctcaccaacagcaatatgactgctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zinc finger, CCHC domain containing 4 - O-6-methylguanine-DNA methyltransferase - nicotinamide nucleotide transhydrogenase - chromosome 10 open reading frame 10 |