Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RAB35-RAB35, member RAS oncogene family Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RAB35-RAB35, member RAS oncogene family Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015931 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RAB35 |
| Origin species: | Human |
| Product name: | RAB35-RAB35, member RAS oncogene family Gene |
| Size: | 2ug |
| Accessions: | BC015931 |
| Gene id: | 11021 |
| Gene description: | RAB35, member RAS oncogene family |
| Synonyms: | RAB35, member RAS oncogene family; H-ray; RAB1C; RAY; ras-related protein Rab-35; GTP-binding protein RAY; ras-related protein rab-1c (GTP-binding protein ray) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcccgggactacgaccacctcttcaagctgctcatcatcggcgacagcggtgtgggcaagagcagtttactgttgcgttttgcagacaacactttctcaggcagctacatcaccacgatcggagtggatttcaagatccggaccgtggagatcaacggggagaaggtgaagctgcagatctgggacacagcggggcaggagcgcttccgcaccatcacctccacgtattatcgggggacccacggggtcattgtggtttacgacgtcaccagtgccgagtcctttgtcaacgtcaagcggtggcttcacgaaatcaaccagaactgtgatgatgtgtgccgaatattagtgggtaataagaatgacgaccctgagcggaaggtggtggagacggaagatgcctacaaattcgccgggcagatgggcatccagttgttcgagaccagcgccaaggagaatgtcaacgtggaagagatgttcaactgcatcacggagctggtcctccgagcaaagaaagacaacctggcaaaacagcagcagcaacaacagaacgatgtggtgaagctcacgaagaacagtaaacgaaagaaacgctgctgctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RAB13, member RAS oncogene family - RAB18, member RAS oncogene family - TIMP metallopeptidase inhibitor 1 - RAB38, member RAS oncogene family |