MRPS10-mitochondrial ribosomal protein S10 Gene View larger

MRPS10-mitochondrial ribosomal protein S10 Gene

PTXBC012560

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPS10-mitochondrial ribosomal protein S10 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MRPS10-mitochondrial ribosomal protein S10 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012560
Product type: DNA & cDNA
Ncbi symbol: MRPS10
Origin species: Human
Product name: MRPS10-mitochondrial ribosomal protein S10 Gene
Size: 2ug
Accessions: BC012560
Gene id: 55173
Gene description: mitochondrial ribosomal protein S10
Synonyms: MRP-S10; PNAS-122; 28S ribosomal protein S10, mitochondrial; S10mt; mitochondrial 28S ribosomal protein S10; mitochondrial ribosomal protein S10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcgcggacagcgttcggtgctgtgtgccggcgcctctggcagggattggggaatttttctgtaaacacttctaagggcaatacagccaaaaatggtggcttgcttctcagtaccaatatgaagtgggtacagttttcaaacctacacgttgatgttccaaaggatttgaccaaacctgtggtaacaatctctgatgaaccagacatattatataagcgcctctcggttttggtgaaaggtcacgataaggctgtattggacagttatgaatattttgctgtgcttgctgctaaagaacttggtatctctattaaagtacatgaacctccaaggaaaatagagcgatttactcttctccaatcagtgcatatttacaagaagcacagagttcagtatgaaatgagaacactttacagatgtttagagttagaacatctaactggaagcacagcagatgtctacttggaatatattcagcgaaacttacctgaaggggttgccatggaagtaacaaagacacaattagaacagttaccagaacacatcaaggagccaatctgggaaacactatcagaagaaaaagaagaaagcaagtcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 7 open reading frame 42
- mitochondrial ribosomal protein L22
- chromosome 5 open reading frame 30
- mitochondrial ribosomal protein L40

Reviews

Buy MRPS10-mitochondrial ribosomal protein S10 Gene now

Add to cart