PTXBC031674
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC031674 |
Product type: | DNA & cDNA |
Ncbi symbol: | C20orf26 |
Origin species: | Human |
Product name: | C20orf26-chromosome 20 open reading frame 26 Gene |
Size: | 2ug |
Accessions: | BC031674 |
Gene id: | 26074 |
Gene description: | chromosome 20 open reading frame 26 |
Synonyms: | C20orf26; CaM-IP3; dJ1002M8.3; dJ1178H5.4; cilia- and flagella-associated protein 61; cilia and flagella associated protein 61 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgagttatgctttaagccatacaaacagaaaactaacattggaacctaaaattactgtcaatgccaagatcattgtggttggtgcatccagtgttggaatttccttcctagagacattggtattttgctctcacatgaagtttaataatcttaccctgatttcaactcatggactcccaggaaaaaaacttctggacactgaacaaaggaaatttttagccagcgaccactgttttaatgataaagattatgcactgatgtcactgtgctcctgggttaatgtcgtggtgggtagaatgaccggcatagaccgagcagccaagcacgttgtgctttccacggacgagatcgtgccctacgaccacctcatcctctgcaccgggcagcagtaccaggtcccatgccctacagaggctgatattagtcaacacctgacaaacagggaggttcccaacagcagtcagcggcggtacacggggaaagttccttgcaaccatttcactctcaacgaggaagaggattgctttaaggcactgatttggataaggaataactccatcaccacagaagatggaggaagagcatcagtgttattctgctga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - chromosome 19 open reading frame 60 - transmembrane 4 L six family member 1 - zinc finger, CCHC domain containing 4 - O-6-methylguanine-DNA methyltransferase |