PTXBC031875
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC031875 |
Product type: | DNA & cDNA |
Ncbi symbol: | FAM71E2 |
Origin species: | Human |
Product name: | FAM71E2-family with sequence similarity 71, member E2 Gene |
Size: | 2ug |
Accessions: | BC031875 |
Gene id: | 284418 |
Gene description: | family with sequence similarity 71, member E2 |
Synonyms: | protein FAM71E2; C19orf16; family with sequence similarity 71 member E2 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgatctggcttcgaaacaggaggtgccttgagccgctccagggcaccccgaagtgggtccctgttctgggggagctgcaaaagaccctccagaagggcgagtacctgtccctccgtccgctgcccatgttcgagagtaactttgttcaggtgacccatcaagggggcccagtgttcgtgaatcacagaaccaaccggctggccatgggcgtggccgcctccctgccaggcctggtgttgcctgacatcttgctgatcggccagcccgccgaggacagggactgctccggcctcgtgctgaccaggatgatccccctggacctcgtccacctctgcgtccatgacctctctgcctggcgcctgaagctgcgcctggtctcgggccgccagtactacctggccctggacgcccctgacaacgaggtgggcttcctgttccactgctgggtccgcctcatcaacctgcttcaggagccggctcccacctggacccccaggaccacgcgcacggcccccctggatatgccgctggccaaagcgcctgcctccacctggcacctgcaggaccagcccatcagcagacatgcagtcatgggttgctga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - v-crk sarcoma virus CT10 oncogene homolog (avian) - poly (ADP-ribose) polymerase family, member 11 - Notch homolog 2 (Drosophila) N-terminal like - protein phosphatase 1M (PP2C domain containing) |