Cart 29 Product Products 3 842,35 € (empty)
-
-
1 x MGC9913-hy...113,40 € -
1 x DDOST-doli...121,50 € -
1 x GPR82-G...121,50 € -
1 x LOC440905-...113,40 € -
1 x MGC16075-h...113,40 € -
1 x FGFBP1-fib...113,40 € -
1 x CREB3L2-cA...113,40 € -
1 x SNAPC5-sma...113,40 € -
1 x CERK-ceram...113,40 € -
1 x VPS24-vacu...113,40 € -
1 x DMC1-DMC1...121,50 € -
1 x THEG-Theg...121,50 € -
1 x FETUB-fetu...121,50 € -
1 x MYBPC3...259,07 € -
1 x GBAP-gluco...121,50 € -
1 x UBE2O-ubiq...121,50 € -
1 x PACRG-PARK...113,40 € -
1 x AQP5-aquap...113,40 € -
1 x PRSS35-pro...121,50 € -
1 x GBL-G...121,50 € -
1 x CRLS1-card...113,40 € -
1 x SLMO2-slow...113,40 € -
1 x LOC653391-...113,40 € -
1 x PBX2-pre-B...121,50 € -
1 x MGC16025-h...113,40 € -
1 x NT5C3-5'-n...121,50 € -
1 x MARCKSL1-M...113,40 € -
1 x GYPC-glyco...113,40 €
No products
To be determined Shipping
3 842,35 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 29 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 842,35 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 842,35 €
View larger 
KLRG1-killer cell lectin-like receptor subfamily G, member 1 Gene
PTXBC012621
New product
Data sheet of KLRG1-killer cell lectin-like receptor subfamily G, member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KLRG1-killer cell lectin-like receptor subfamily G, member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012621 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KLRG1 |
| Origin species: | Human |
| Product name: | KLRG1-killer cell lectin-like receptor subfamily G, member 1 Gene |
| Size: | 2ug |
| Accessions: | BC012621 |
| Gene id: | 10219 |
| Gene description: | killer cell lectin-like receptor subfamily G, member 1 |
| Synonyms: | 2F1; CLEC15A; MAFA; MAFA-2F1; MAFA-L; MAFA-LIKE; killer cell lectin-like receptor subfamily G member 1; C-type lectin domain family 15 member A; ITIM-containing receptor MAFA-L; MAFA-like receptor; killer cell lectin-like receptor subfamily G, member 1; mast cell function-associated antigen (ITIM-containing); killer cell lectin like receptor G1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgactgacagtgttatttattccatgttagagttgcctacggcaacccaagcccagaatgactatggaccacagcaaaaatcttcctcttccaggccttcttgttcttgccttgtggcaatagctttggggcttctgactgcagttcttctgagtgtgctgctataccagtggatcctgtgccagggctccaactactccacttgtgccagctgtcctagctgcccagaccgctggatgaaatatggtaaccattgttattatttctcagtggaggaaaaggactggaattctagtctggaattctgcctagccagagactcacacctccttgtgataacggacaatcaggaaatgagcctgctccaagttttcctcagtgaggccttttgctggattggtctgaggaacaattctggctggaggtgggaagatggatcacctctaaacttctcaaggatttcttctaatagctttgtgcagacatgcggtgccatcaacaaaaatggtcttcaagcctcaagctgtgaagttcctttacactgggtgtgtaagaagtgtccctttgcagatcaagctttattctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - proteasome (prosome, macropain) subunit, alpha type, 8 - THAP domain containing, apoptosis associated protein 1 - ADP-ribosylation-like factor 6 interacting protein 4 - ADP-ribosylation-like factor 6 interacting protein 6 |