SLMO2-slowmo homolog 2 (Drosophila) Gene View larger

SLMO2-slowmo homolog 2 (Drosophila) Gene

PTXBC010649

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLMO2-slowmo homolog 2 (Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLMO2-slowmo homolog 2 (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010649
Product type: DNA & cDNA
Ncbi symbol: SLMO2
Origin species: Human
Product name: SLMO2-slowmo homolog 2 (Drosophila) Gene
Size: 2ug
Accessions: BC010649
Gene id: 51012
Gene description: slowmo homolog 2 (Drosophila)
Synonyms: SLMO2; C20orf45; dJ543J19.5; PRELI domain containing protein 3B; protein slowmo homolog 2; slowmo homolog 2; PRELI domain containing 3B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagatctggacttcggagcacgtctttgaccacccgtgggaaactgttacaacagctgcaatgcagaaatacccaaaccctatgaacccaagtgtggttggagttgatgtgttggacagacatatagatccctctggaaagttgcacagccacagacttctcagcacagagtggggactgccttccattgtgaagtctcttattggtgcagcaagaacgaaaacatatgtgcaagaacattctgtagttgatcctgtagagaaaacaatggaacttaaatctactaatatttcatttacaaacatggtttcagtagatgagagacttatatacaaaccacatcctcaggatccagaaaaaactgttttgacacaagaagccataattaccgtgaaaggagttagcctcagcagttaccttgaaggactgatggcaagtacgatatcctcaaatgctagtaaaggccgagaagcaatggaatgggtaatacataaattaaatgctgagattgaagaactgacagcctcagcaagaggaaccataaggactccaatggcagcagcagcgtttgcagagaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transmembrane protein 126B
- secreted and transmembrane 1
- kallikrein-related peptidase 7
- ethylmalonic encephalopathy 1

Reviews

Buy SLMO2-slowmo homolog 2 (Drosophila) Gene now

Add to cart