H1F0-H1 histone family, member 0 Gene

View larger

H1F0-H1 histone family, member 0 Gene

Reference: PTXBC000145

Condition: New product

Print

Data sheet of H1F0-H1 histone family, member 0 Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about H1F0-H1 histone family, member 0 Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC000145
Product type:	DNA & cDNA
Ncbi symbol:	H1F0
Origin species:	Human
Product name:	H1F0-H1 histone family, member 0 Gene
Size:	2ug
Accessions:	BC000145
Gene id:	3005
Gene description:	H1 histone family, member 0
Synonyms:	H10; H1FV; histone H1.0; H1.0, H1(0), H1-0; histone H1'; histone H1(0); H1 histone family member 0
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgaccgagaattccacgtccgcccctgcggccaagcccaagcgggccaaggcctccaagaagtccacagaccaccccaagtattcagacatgatcgtggctgccatccaggccgagaagaaccgcgctggctcctcgcgccagtccattcagaagtatatcaagagccactacaaggtgggtgagaacgctgactcgcagatcaagttgtccatcaagcgcctggtcaccaccggtgtcctcaagcagaccaaaggggtgggggcctcggggtccttccggctagccaagagcgacgaacccaagaagtcagtggccttcaagaagaccaagaaggaaatcaagaaggtagccacgccaaagaaggcatccaagcccaagaaggctgcctccaaagccccaaccaagaaacccaaagccaccccggtcaagaaggccaagaagaagctggctgccacgcccaagaaagccaaaaaacccaagactgtcaaagccaagccggtcaaggcatccaagcccaaaaaggccaaaccagtgaaacccaaagcaaagtccagtgccaagagggccggcaagaagaagtga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- CD164 molecule, sialomucin - B-cell translocation gene 4 - clathrin, light chain (Lcb) - myelin expression factor 2

Reviews

Be the first to write your review !

Buy H1F0-H1 histone family, member 0 Gene now