PDCD6-programmed cell death 6 Gene View larger

PDCD6-programmed cell death 6 Gene

PTXBC012384

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PDCD6-programmed cell death 6 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PDCD6-programmed cell death 6 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012384
Product type: DNA & cDNA
Ncbi symbol: PDCD6
Origin species: Human
Product name: PDCD6-programmed cell death 6 Gene
Size: 2ug
Accessions: BC012384
Gene id: 10016
Gene description: programmed cell death 6
Synonyms: ALG-2; ALG2; PEF1B; programmed cell death protein 6; apoptosis-linked gene 2 protein; programmed cell death 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgcctactcttaccgccccggccctggggccggccctgggcctgctgcaggcgcggcgctgccggaccagagcttcctgtggaacgttttccagagggtcgataaagacaggagtggagtgatatcagacaccgagcttcagcaagctctctccaacggcacgtggactccctttaatccagtgactgtcaggtcgatcatatccatgtttgaccgtgagaacaaggccggcgtgaacttcagcgagttcacgggtgtgtggaagtacatcacggactggcagaacgtcttccgcacgtacgaccgggacaactccgggatgatcgataagaacgagctgaagcaggccctctcaggtttcggctaccggctctctgaccagttccacgacatcctcattcgaaagtttgacaggcagggacgggggcagattgccttcgacgacttcatccagggctgcatcgtcctgcagaggttgacggatatattcagacgttacgacacggatcaggacggctggattcaggtgtcgtacgaacagtacctgtccatggtcttcagtatcgtatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - phosphomevalonate kinase
- phospholipase C, beta 2
- ribosomal protein L10a
- TM2 domain containing 3

Reviews

Buy PDCD6-programmed cell death 6 Gene now

Add to cart