Cart 17 Product Products 2 449,15 € (empty)
-
-
1 x MGC9913-hy...113,40 € -
1 x DDOST-doli...121,50 € -
1 x GPR82-G...121,50 € -
1 x LOC440905-...113,40 € -
1 x MGC16075-h...113,40 € -
1 x FGFBP1-fib...113,40 € -
1 x CREB3L2-cA...113,40 € -
1 x SNAPC5-sma...113,40 € -
1 x CERK-ceram...113,40 € -
1 x VPS24-vacu...113,40 € -
1 x DMC1-DMC1...121,50 € -
1 x THEG-Theg...121,50 € -
1 x FETUB-fetu...121,50 € -
1 x MYBPC3...259,07 € -
1 x GBAP-gluco...121,50 € -
1 x UBE2O-ubiq...121,50 €
No products
To be determined Shipping
2 449,15 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 17 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 449,15 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 449,15 €
View larger 
PARK7-Parkinson disease (autosomal recessive, early onset) 7 Gene
PTXBC008188
New product
Data sheet of PARK7-Parkinson disease (autosomal recessive, early onset) 7 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PARK7-Parkinson disease (autosomal recessive, early onset) 7 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008188 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PARK7 |
| Origin species: | Human |
| Product name: | PARK7-Parkinson disease (autosomal recessive, early onset) 7 Gene |
| Size: | 2ug |
| Accessions: | BC008188 |
| Gene id: | 11315 |
| Gene description: | Parkinson disease (autosomal recessive, early onset) 7 |
| Synonyms: | DJ-1; DJ1; HEL-S-67p; protein deglycase DJ-1; Parkinson disease (autosomal recessive, early onset) 7; epididymis secretory sperm binding protein Li 67p; oncogene DJ1; parkinson protein 7; protein DJ-1; Parkinsonism associated deglycase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcttccaaaagagctctggtcatcctggctaaaggagcagaggaaatggagacggtcatccctgtagatgtcatgaggcgagctgggattaaggtcaccgttgcaggcctggctggaaaagacccagtacagtgtagccgtgatgtggtcatttgtcctgatgccagccttgaagatgcaaaaaaagagggaccatatgatgtggtggttctaccaggaggtaatctgggtgcacagaatttatctgagtctgctgctgtgaaggagatactgaaggagcaggaaaaccggaagggcctgatagccgccatctgtgcaggtcctactgctctgttggctcatgaaataggttttggaagtaaagttacaacacaccctcttgctaaagacaaaatgatgaatggaggtcattacacctactctgagaatcgtgtggaaaaagacggcctgattcttacaagccgggggcctgggaccagcttcgagtttgcgcttgcaattgttgaagccctgaatggcaaggaggtggcggctcaagtgaaggctccacttgttcttaaagactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - killer cell lectin-like receptor subfamily G, member 1 - proteasome (prosome, macropain) subunit, alpha type, 8 - THAP domain containing, apoptosis associated protein 1 - ADP-ribosylation-like factor 6 interacting protein 4 |