Cart 5 Product Products 874,40 € (empty)
-
-
1 x ZBTB43-zin...121,50 € -
1 x BCAT2-bran...121,50 € -
1 x FLJ32063-h...113,40 € -
No products
To be determined Shipping
874,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 874,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 874,40 €
View larger 
PLEKHB1-pleckstrin homology domain containing, family B (evectins) member 1 Gene
PTXBC008075
New product
Data sheet of PLEKHB1-pleckstrin homology domain containing, family B (evectins) member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PLEKHB1-pleckstrin homology domain containing, family B (evectins) member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008075 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PLEKHB1 |
| Origin species: | Human |
| Product name: | PLEKHB1-pleckstrin homology domain containing, family B (evectins) member 1 Gene |
| Size: | 2ug |
| Accessions: | BC008075 |
| Gene id: | 58473 |
| Gene description: | pleckstrin homology domain containing, family B (evectins) member 1 |
| Synonyms: | PHR1; PHRET1; pleckstrin homology domain-containing family B member 1; PH domain containing, retinal 1; PH domain-containing family B member 1; PH domain-containing protein in retina 1; evectin-1; pleckstrin homology domain containing, family B (evectins) member 1; pleckstrin homology domain retinal protein 1; pleckstrin homology domain containing B1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccctggtgaggggcggctggctgtggagacagagctccatcctccgccgctggaagcggaactggtttgccctgtggctggacgggaccctgggatactaccacgatgagacagcgcaggacgaggaggaccgtgtgctcatccacttcaatgtccgtgacataaagatcggcccagagtgccatgatgtgcagcccccagagggccggagccgagatggcctgctgactgtgaacctacgggaaggcggccgcctgcacctctgtgcggagaccaaggatgatgccctagcatggaagacagcactgctggaggcaaactccaccccggtgcgcgtctacagcccgtaccaagactactacgaggtggtgccccccaatgcacacgaggccacgtatgtccgcagctactacggaccgccctacgcaggccctggcgtgacgcacgtgatagtgcgggaggatccctgctacagcgccggcgcccctctggccatgggcatgcttgcgggagccgccactggggcggcgctgggctcgctcatgtggtcgccctgctggttctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa - sulfotransferase family, cytosolic, 1A, phenol-preferring, member 1 - phosphatidylinositol-specific phospholipase C, X domain containing 1 - KH domain containing, RNA binding, signal transduction associated 2 |