NME4-non-metastatic cells 4, protein expressed in Gene View larger

NME4-non-metastatic cells 4, protein expressed in Gene

PTXBC017067

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NME4-non-metastatic cells 4, protein expressed in Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NME4-non-metastatic cells 4, protein expressed in Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017067
Product type: DNA & cDNA
Ncbi symbol: NME4
Origin species: Human
Product name: NME4-non-metastatic cells 4, protein expressed in Gene
Size: 2ug
Accessions: BC017067
Gene id: 4833
Gene description: non-metastatic cells 4, protein expressed in
Synonyms: NDPK-D; NM23H4; nm23-H4; nucleoside diphosphate kinase, mitochondrial; NDK; NDP kinase D; NDP kinase, mitochondrial; NDPKD; non-metastatic cells 4, protein expressed in; nucleoside diphosphate kinase D; NME/NM23 nucleoside diphosphate kinase 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcggcctcttctggcgctccgcgctgcgggggctgcgctgcggcccgcgggccccgggcccgagcctgctagtgcgccacggctcgggagggccctcctggacccgggagcggaccctggtggcggtgaagcccgatggcgtgcaacggcggctcgttggggacgtgatccagcgctttgagaggcggggcttcacgctggtggggatgaagatgctgcaggcaccagagagcgtccttgccgagcactaccaggacctgcggaggaagcccttctaccctgccctcatccgctacatgagctctgggcctgtggtggccatggtctgggaagggtacaatgtcgtccgcgcctcaagggccatgattggacacaccgactcggctgaggctgccccaggaaccataaggggtgacttcagcgtccacatcagcaggaatgtcatccacgccagcgactccgtggagggggcccagcgggagatccagctgtggttccagagcagtgagctggtgagctgggcagatgggggccagcacagcagcatccacccagcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - non-metastatic cells 4, protein expressed in
- eukaryotic translation initiation factor 4E
- eukaryotic translation initiation factor 4H
- RNA-binding region (RNP1, RRM) containing 3

Reviews

Buy NME4-non-metastatic cells 4, protein expressed in Gene now

Add to cart