Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
TNFAIP8L1-tumor necrosis factor, alpha-induced protein 8-like 1 Gene
PTXBC017672
New product
Data sheet of TNFAIP8L1-tumor necrosis factor, alpha-induced protein 8-like 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TNFAIP8L1-tumor necrosis factor, alpha-induced protein 8-like 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017672 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TNFAIP8L1 |
| Origin species: | Human |
| Product name: | TNFAIP8L1-tumor necrosis factor, alpha-induced protein 8-like 1 Gene |
| Size: | 2ug |
| Accessions: | BC017672 |
| Gene id: | 126282 |
| Gene description: | tumor necrosis factor, alpha-induced protein 8-like 1 |
| Synonyms: | TIPE1; tumor necrosis factor alpha-induced protein 8-like protein 1; TNF alpha-induced protein 8-like protein 1; TNFAIP8-like protein 1; oxidative stress-regulated gene-beta; oxy-beta; tumor necrosis factor, alpha induced protein 8 like 1; tumor necrosis factor, alpha-induced protein 8-like protein 1; TNF alpha induced protein 8 like 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacaccttcagcaccaagagcctggctctgcaggcgcagaagaagctcctgagtaagatggcgtccaaggcagtggtggccgtgctggtggatgacaccagcagtgaggtgctggatgagctgtaccgcgccaccagggagttcacgcgcagccgcaaggaggcccagaagatgctcaagaacctggtcaaggtggccctgaagctgggactgctgctgcgtggggaccagctgggcggtgaggagctggcgctgctgcggcgcttccgccaccgggcgcgctgcctggccatgacggccgtcagcttccaccaggtggacttcaccttcgaccggcgcgtgctggccgtcgggctgctcgagtgccgcgacctgctgcaccaggccgtgggtccccacctgaccgccaagtcccacggccgcatcaaccacgtgttcggccacctagccgactgcgacttcctggctgcgctctacggccccgccgagccctaccgctcccacctgcgcaggatctgcgagggcctgggccggatgctggacgagggcagcctctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cysteine and glycine-rich protein 3 (cardiac LIM protein) - chorionic somatomammotropin hormone 1 (placental lactogen) - transmembrane emp24 protein transport domain containing 5 - leucine zipper-EF-hand containing transmembrane protein 2 |