Cart 2 Product Products 234,90 € (empty)
-
1 x KCTD14-pot...113,40 € -
1 x CGRRF1-cel...121,50 €
No products
To be determined Shipping
234,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 234,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 234,90 €
View larger 
Data sheet of SLC25A26-solute carrier family 25, member 26 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC25A26-solute carrier family 25, member 26 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012852 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC25A26 |
| Origin species: | Human |
| Product name: | SLC25A26-solute carrier family 25, member 26 Gene |
| Size: | 2ug |
| Accessions: | BC012852 |
| Gene id: | 115286 |
| Gene description: | solute carrier family 25, member 26 |
| Synonyms: | COXPD28; SAMC; S-adenosylmethionine mitochondrial carrier protein; mitochondrial S-adenosylmethionine transporter; solute carrier family 25 (S-adenosylmethionine carrier), member 26; solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 26; solute carrier family 25 member 26 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaacatatgttggctgcctctgctggagaagtggttgcctgcctgattcgagttccatctgaagtggttaagcagagggcacaggtatctgcttctacaagaacatttcagattttctctaacatcttatatgaagagggtatccaagggttgtatcgaggctataaaagcacagttttaagagagattcctttttctttggtccagtttcccttatgggagtccttaaaagccctctggtcctggaggcaggatcatgtggtggattcttggcagtcagcagtctgtggagcttttgcaggtggatttgccgctgcagtcaccacccctctagacgtggcaaagacaagaattacgctggcaaaggctggctccagcactgctgatgggaatgtgctctctgtcctgcatggggtctggcggtcacaggggctggcaggattatttgcaggtgtcttccctcgaatggcagccatcagtctgggaggtttcatctttctgggggcttatgaccgaacgcacagcttgctgttggaagttggcagaaagagtccttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 20 open reading frame 26 - chromosome 19 open reading frame 60 - transmembrane 4 L six family member 1 - zinc finger, CCHC domain containing 4 |