Cart 24 Product Products 2 729,07 € (empty)
-
1 x C11orf67-c...113,40 € -
1 x MDP-1-magn...113,40 € -
1 x PTS-6-pyru...113,40 € -
1 x PARP6-poly...121,50 € -
-
1 x LST1-leuko...113,40 € -
1 x BEX5-brain...113,40 € -
-
-
1 x FTL-ferrit...113,40 € -
1 x SPATA3-spe...113,40 € -
1 x C16orf65-c...113,40 € -
1 x TRIM31-tri...113,40 € -
1 x EIF3E-euka...121,50 € -
1 x WBP2NL-WBP...113,40 € -
1 x KIR2DL1-ki...121,50 € -
1 x NDUFB1-NAD...113,40 € -
-
1 x C19orf34-c...113,40 € -
-
1 x TCN2-trans...121,50 € -
1 x NECAP1-NEC...113,40 € -
1 x IL21-inter...113,40 € -
No products
To be determined Shipping
2 729,07 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 24 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 729,07 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 729,07 €
Data sheet of RBBP9-retinoblastoma binding protein 9 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RBBP9-retinoblastoma binding protein 9 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015938 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RBBP9 |
| Origin species: | Human |
| Product name: | RBBP9-retinoblastoma binding protein 9 Gene |
| Size: | 2ug |
| Accessions: | BC015938 |
| Gene id: | 10741 |
| Gene description: | retinoblastoma binding protein 9 |
| Synonyms: | BOG; RBBP10; B5T overexpressed gene protein; RBBP-10; RBBP-9; retinoblastoma-binding protein 10; retinoblastoma-binding protein 9; retinoma-binding protein 9; RB binding protein 9, serine hydrolase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcttctcctagcaaggcagtgattgttcccgggaacggaggcggggatgtgaccacccacggctggtatggctgggtgaaaaaggagctggagaagatacctggtttccagtgtttggctaaaaacatgcccgacccaattacagcacgagagagcatctggctgcccttcatggagacagagctgcactgtgatgagaagactatcatcattggccacagttctggggccatcgcggccatgaggtatgcagaaacacatcgagtatatgctattgtattagtgtctgcgtacacatcagacttgggggatgaaaatgagcgtgcaagtggatacttcacccgcccctggcagtgggagaagatcaaggccaactgcccttacattgtgcagtttggctctactgacgacccgttccttccctggaaggaacaacaagaagtggccgataggttggaaaccaaattgcacaaattcactgactgtggccactttcagaacacagagtttcatgaactgattactgttgtaaagtctttgctgaaagtaccagcatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical protein MGC16385 - interleukin 6 (interferon, beta 2) - gypsy retrotransposon integrase 1 - hypothetical protein FLJ22662 |