GLO1-glyoxalase I Gene View larger

GLO1-glyoxalase I Gene

PTXBC011365

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GLO1-glyoxalase I Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GLO1-glyoxalase I Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011365
Product type: DNA & cDNA
Ncbi symbol: GLO1
Origin species: Human
Product name: GLO1-glyoxalase I Gene
Size: 2ug
Accessions: BC011365
Gene id: 2739
Gene description: glyoxalase I
Synonyms: GLOD1; GLYI; HEL-S-74; lactoylglutathione lyase; S-D-lactoylglutathione methylglyoxal lyase; aldoketomutase; epididymis secretory protein Li 74; glx I; glyoxalase domain containing 1; ketone-aldehyde mutase; lactoyl glutathione lyase; methylglyoxalase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagaaccgcagcccccgtccggcggcctcacggacgaggccgccctcagttactgctccgacgcggaccccagtaccaaggattttctattgcagcagaccatgctacgagtgaaggatcctaagaagtcactggatttttatactagagttcttggaatgacgctaatccaaaaatgtgattttcccattatgaagttttcactctacttcttggcttatgaggataaaaatgacatccctaaagaaaaagatgaaaaaatagcctgggcgctctccagaaaagctacacttgagctgacacacaattggggcactgaagatgatgagacccagagttaccacaatggcaattcagaccctcgaggattcggtcatattggaattgctgttcctgatgtatacagtgcttgtaaaaggtttgaagaactgggagtcaaatttgtgaagaaacctgatgatggtaaaatgaaaggcctggcatttattcaagatcctgatggctactggattgaaattttgaatcctaacaaaatggcaaccttaatgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - dermatopontin
- claudin 11
- endothelin 1
- KIAA0907

Reviews

Buy GLO1-glyoxalase I Gene now

Add to cart