PTXBC000176
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC000176 |
Product type: | DNA & cDNA |
Ncbi symbol: | RAP1B |
Origin species: | Human |
Product name: | RAP1B-RAP1B, member of RAS oncogene family Gene |
Size: | 2ug |
Accessions: | BC000176 |
Gene id: | 5908 |
Gene description: | RAP1B, member of RAS oncogene family |
Synonyms: | RAP1B, member of RAS oncogene family; Ras family small GTP binding protein RAP1B; RAS-related protein RAP1B; K-REV; RAL1B; ras-related protein Rap-1b; GTP-binding protein smg p21B; small GTP binding protein |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgcgtgagtataagctagtcgttcttggctcaggaggcgttggaaagtctgctttgactgtacaatttgttcaaggaatttttgtagaaaaatacgatcctacgatagaagattcttatagaaagcaagttgaagtagatgcacaacagtgtatgcttgaaatcttggatactgcaggaacggagcaatttacagcaatgagggatttatacatgaaaaatggacaaggatttgcattagtttattccatcacagcacagtccacatttaacgatttacaagacctgagagaacagattcttcgagttaaagacactgatgatgttccaatgattcttgttggtaataagtgtgacttggaagatgaaagagttgtagggaaggaacaaggtcaaaatctagcaagacaatggaacaactgtgcattcttagaatcttctgcaaaatcaaaaataaatgttaatgagatcttttatgacctagtgcggcaaattaacagaaaaactccagtgcctgggaaggctcgcaaaaagtcatcatgtcagctgctttaa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - mitochondrial ribosomal protein S28 - chromosome 7 open reading frame 50 - golgi SNAP receptor complex member 2 - integrin beta 1 binding protein 1 |