Cart 1 Product Products 113,40 € (empty)
-
1 x JOSD1-Jose...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
Data sheet of FKSG24-hypothetical protein MGC12972 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FKSG24-hypothetical protein MGC12972 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005064 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FKSG24 |
| Origin species: | Human |
| Product name: | FKSG24-hypothetical protein MGC12972 Gene |
| Size: | 2ug |
| Accessions: | BC005064 |
| Gene id: | 84769 |
| Gene description: | hypothetical protein MGC12972 |
| Synonyms: | FKSG24; mpv17-like protein 2; MPV17 mitochondrial membrane protein-like 2; MPV17 mitochondrial inner membrane protein like 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgcggggtggctggcgccggctacgccgcctgttatccgcggggcagcttctattccagggccgcgcgctgctcgtcactaacacgctgggctgcggcgcgctcatggcggccggtgatggcgtgcgccagtcctgggagatccgcgcccggcccggccaggttttcgacccacggcgctccgcgagcatgtttgcggtgggctgcagcatgggtcccttcctgcactactggtacttgtcgctggaccgcctattccctgcgtctggcctccgaggcttcccaaatgtcctcaagaaggtcctcgtggatcagctggtagcctctccattgctgggcgtctgggaattctacaaggcagactggtgcgtgtggcctgctgcgcagttcgtgaacttcctcttcgtgcccccccaatttcgagtcacctacatcaacggcctgacgctgggctgggacacgtacctgtcctacttgaagtaccggagcccagttcctctgacacccccaggctgtgtggccctggacacccgagcagactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - methylphosphate capping enzyme - unc-84 homolog A (C. elegans) - TGFB-induced factor homeobox 1 - peroxisomal biogenesis factor 7 |