Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
EIF4A2-eukaryotic translation initiation factor 4A, isoform 2 Gene
PTXBC016295
New product
Data sheet of EIF4A2-eukaryotic translation initiation factor 4A, isoform 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about EIF4A2-eukaryotic translation initiation factor 4A, isoform 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016295 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | EIF4A2 |
| Origin species: | Human |
| Product name: | EIF4A2-eukaryotic translation initiation factor 4A, isoform 2 Gene |
| Size: | 2ug |
| Accessions: | BC016295 |
| Gene id: | 1974 |
| Gene description: | eukaryotic translation initiation factor 4A, isoform 2 |
| Synonyms: | BM-010; DDX2B; EIF4A; EIF4F; eIF-4A-II; eIF4A-II; eukaryotic initiation factor 4A-II; ATP-dependent RNA helicase eIF4A-2; eukaryotic translation initiation factor 4A2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagagatccaattcgaattctggtgaaaaaggaagaattgacccttgaaggaatcaaacagttttatattaatgttgagagagaggaatggaagttggatacactttgtgacttgtacgagacactgaccattacacaggctgttatttttctcaatacgaggcgcaaggtggactggctgactgagaagatgcatgccagagacttcacagtttctgctctgcatggtgacatggaccagaaggagagagatgttatcatgagggaattccggtcagggtcaagtcgtgttctgatcactactgacttgttggctcgcgggattgatgtgcaacaagtgtctttggttataaattatgatctacctaccaatcgtgaaaactatattcacagaattggcagagggggtcgatttgggaggaaaggtgtggctataaactttgttactgaagaagacaagaggattcttcgtgacattgagactttctacaatactacagtggaggagatgcccatgaatgtggctgaccttatttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - TRAF-interacting protein with forkhead-associated domain - MOB1, Mps One Binder kinase activator-like 2B (yeast) - solute carrier family 30 (zinc transporter), member 6 - potassium channel tetramerisation domain containing 14 |