Cart 34 Product Products 4 719,00 € (empty)
-
1 x HFM1-HFM1,...121,50 € -
1 x DAZ3-delet...121,50 € -
-
1 x SERINC3-se...121,50 € -
1 x SERPINB1-s...121,50 € -
-
1 x SERBP1-SER...121,50 € -
1 x PSMG3-prot...113,40 € -
1 x CCM2-cereb...113,40 € -
1 x ZDHHC20-zi...113,40 € -
-
-
-
-
1 x SERPINB11-...121,50 € -
1 x KRT8-kerat...121,50 € -
-
-
1 x ZNF673-zin...113,40 € -
1 x CCNB1IP1-c...121,50 € -
1 x IFT20-intr...113,40 € -
1 x MAGEC3-mel...121,50 € -
1 x HP-haptogl...121,50 € -
1 x Donkey...223,00 € -
1 x OLA1-Obg-l...121,50 € -
1 x hCG_173187...113,40 € -
1 x IFI30-inte...113,40 € -
1 x NAT1-N-ace...121,50 € -
1 x IFT81-intr...113,40 € -
1 x EDA-ectody...121,50 € -
1 x OAZ1-ornit...113,40 € -
1 x APOBEC4...259,07 € -
-
No products
To be determined Shipping
4 719,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 34 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 719,00 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 719,00 €
Data sheet of DCTD-dCMP deaminase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DCTD-dCMP deaminase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001286 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DCTD |
| Origin species: | Human |
| Product name: | DCTD-dCMP deaminase Gene |
| Size: | 2ug |
| Accessions: | BC001286 |
| Gene id: | 1635 |
| Gene description: | dCMP deaminase |
| Synonyms: | dCMP deaminase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtgaagtttcctgcaagaaacgggacgactatttggaatggccagagtattttatggctgtggccttcttatcagcacagagaagcaaagatccaaattcccaggtcggcgcctgcatcgtgaattcagaaaacaagattgtcgggattgggtacaatgggatgccaaatgggtgcagtgatgacgtgttgccttggagaaggacagcagagaataagctggacaccaaatacccgtacgtgtgccatgcggagctgaatgccatcatgaacaaaaatttgaccgatgtgaaaggctgtagtatgtatgtcgccttgttcccttgtaatgaatgcgctaagctcatcatccaggcaggtataaaagaagtgattttcatgtctgataaataccatgatagtgacgaggcaactgctgcgaggctcctgtttaatatggccggggtgacattccggaaattcataccgaagtgcagcaagattgtcattgactttgattcaattaacagcagaccgagtcaaaagcttcagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - transgelin 3 - latrophilin 1 - interleukin 24 - interleukin 32 |