Cart 40 Product Products 5 826,30 € (empty)
-
1 x C-Reactive...544,00 € -
1 x M6PR-manno...121,50 € -
-
1 x SPANXE-SPA...113,40 € -
1 x ARC-activi...121,50 € -
1 x SMCP-sperm...113,40 € -
-
1 x TM4SF18-tr...113,40 € -
1 x GC-group-s...121,50 € -
1 x NEU4-siali...121,50 € -
1 x TMEM31-tra...113,40 € -
1 x PLA2G2D-ph...113,40 € -
1 x C20orf177-...121,50 € -
1 x WDR53-WD...121,50 € -
1 x CCL22-chem...113,40 € -
1 x PRRG4-prol...113,40 € -
1 x MGC87631-s...113,40 € -
-
-
1 x POLB-polym...121,50 € -
1 x ANXA8-anne...121,50 € -
-
-
1 x ATPAF2-ATP...121,50 € -
1 x HTR2B-5-hy...121,50 € -
1 x GSTK1-glut...113,40 € -
-
1 x TMEM55A-tr...113,40 € -
1 x ORAI1-ORAI...113,40 € -
-
1 x ASB7-ankyr...121,50 € -
-
1 x WFDC9-WAP...113,40 € -
-
-
-
1 x CCNL1-cycl...113,40 € -
1 x UBE2T-ubiq...113,40 € -
-
-
1 x ATG4D-ATG4...121,50 €
No products
To be determined Shipping
5 826,30 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 40 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 5 826,30 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 5 826,30 €
View larger 
Data sheet of PPIH-peptidylprolyl isomerase H (cyclophilin H) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPIH-peptidylprolyl isomerase H (cyclophilin H) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003412 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPIH |
| Origin species: | Human |
| Product name: | PPIH-peptidylprolyl isomerase H (cyclophilin H) Gene |
| Size: | 2ug |
| Accessions: | BC003412 |
| Gene id: | 10465 |
| Gene description: | peptidylprolyl isomerase H (cyclophilin H) |
| Synonyms: | CYP-20; CYPH; SnuCyp-20; USA-CYP; peptidyl-prolyl cis-trans isomerase H; PPIase h; U-snRNP-associated cyclophilin SnuCyp-20; U-snRNP-associated cyclophilin SunCyp-20; USA-CyP SnuCyp-20; cyclophilin H; rotamase H; small nuclear ribonucleoprotein particle-specific cyclophilin H; peptidylprolyl isomerase H |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggtggcaaattcaagtcctgttaaccccgtggtgttctttgatgtcagtattggcggtcaggaagttggccgcatgaagatcgagctctttgcagacgttgtgcctaagacggccgagaactttaggcagttctgcaccggagaattcaggaaagatggggttccaataggatacaaaggaagcaccttccacagggtcataaaggatttcatgattcagggtggagattttgttaatggagatggtactggagtcgccagtatttaccgggggccatttgcagatgaaaattttaaacttagacactcagctccaggcctgctttccatggcgaacagtggtccaagtacaaatggctgtcagttctttatcacctgctctaagtgcgattggctggatgggaagcatgtggtgtttggaaaaatcatcgatggacttctagtgatgagaaagattgagaatgttcccacaggccccaacaataagcccaagctacctgtggtgatctcgcagtgtggggagatgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - peptidylprolyl isomerase C (cyclophilin C) - lysosomal protein transmembrane 4 alpha - CCR4-NOT transcription complex, subunit 7 - F-box and leucine-rich repeat protein 18 |