Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MYL7-myosin, light chain 7, regulatory Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MYL7-myosin, light chain 7, regulatory Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC027915 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MYL7 |
| Origin species: | Human |
| Product name: | MYL7-myosin, light chain 7, regulatory Gene |
| Size: | 2ug |
| Accessions: | BC027915 |
| Gene id: | 58498 |
| Gene description: | myosin, light chain 7, regulatory |
| Synonyms: | MYL2A; MYLC2A; myosin regulatory light chain 2, atrial isoform; MLC-2a; MLC2a; myosin light chain 2a; myosin regulatory light chain 7; myosin, light chain 7, regulatory; myosin, light polypeptide 7, regulatory; myosin light chain 7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccagcaggaaggcggggacccggggcaaggtggcagccaccaagcaggcccaacgtggttcttccaacgtcttttccatgtttgaacaagcccagatacaggagttcaaagaagccttcagctgtatcgaccagaatcgtgatggcatcatctgcaaggcagacctgagggagacctactcccagctggggaaggtgagtgtcccagaggaggagctggacgccatgctgcaagagggcaagggccccatcaacttcaccgtcttcctcacgctctttggggagaagctcaatgggacagaccccgaggaagccatcctgagtgccttccgcatgtttgaccccagcggcaaaggggtggtgaacaaggatgagttcaagcagcttctcctgacccaggcagacaagttctctccagctgaggtggagcagatgttcgccctgacacccatggacctggcggggaacatcgactacaagtcactgtgctacatcatcacccatggagacgagaaagaggaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ubiquitin-conjugating enzyme E2C - retinoblastoma binding protein 9 - hypothetical protein MGC16385 - interleukin 6 (interferon, beta 2) |