Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of FAM156A-family with sequence similarity 156, member A Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FAM156A-family with sequence similarity 156, member A Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000867 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FAM156A |
| Origin species: | Human |
| Product name: | FAM156A-family with sequence similarity 156, member A Gene |
| Size: | 2ug |
| Accessions: | BC000867 |
| Gene id: | 29057 |
| Gene description: | family with sequence similarity 156, member A |
| Synonyms: | protein FAM156A; protein FAM156A/FAM156B; PRO0659; TMEM29; transmembrane protein 29; transmembrane protein 29/29B; family with sequence similarity 156 member A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatgggcctcagtaacctgagccccggtcctggccccagccaggccgtgcctctcccagaggggctgctccgccagcggtacagagaggagaagaccctggaagagcggcggtgggagaggctggagttccttcagaggaagaaagcattcctgcggcatgtgaggaggagacaccgcgatcacatggccccctatgctgttgggagggaagccagaatctccccattaggtgacagaagtcagaatcgattccgatgtgaatgtcgatactgccagagccacaggccgaatctttctgggatccctggggagagtaacagggccccacatccctcctcctgggagacgctggtgcagggcctcagtggcttgactctcagcctaggcaccaaccagcccgggcctctgcctgaagcggcactccagccacaggagacagaggagaagcgccagcgagagaggcagcaggagagcaaaataatgtttcagaggctgctcaagcagtggttagaggaaaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NFS1 nitrogen fixation 1 homolog (S. cerevisiae) - family with sequence similarity 71, member E2 - v-crk sarcoma virus CT10 oncogene homolog (avian) - poly (ADP-ribose) polymerase family, member 11 |