Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of C6orf108-chromosome 6 open reading frame 108 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C6orf108-chromosome 6 open reading frame 108 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011683 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C6orf108 |
| Origin species: | Human |
| Product name: | C6orf108-chromosome 6 open reading frame 108 Gene |
| Size: | 2ug |
| Accessions: | BC011683 |
| Gene id: | 10591 |
| Gene description: | chromosome 6 open reading frame 108 |
| Synonyms: | C6orf108; RCL; dJ330M21.3; 2'-deoxynucleoside 5'-phosphate N-hydrolase 1; c-Myc-responsive protein RCL; deoxyribonucleoside 5'-monophosphate N-glycosidase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgctgccatggtgccggggcgcagcgagagctgggagcgcggggagcctggccgcccggccctgtacttctgcgggagcattcgcggcggacgcgaggacaggacgctgtacgagcggatcgtgtctcggctgcggcgattcgggacagtgctcaccgagcacgtggcggccgccgagctgggcgcgcgcggggaagaggctgctgggggtgacaggctcatccatgagcaggacctggagtggctgcagcaggcggacgtggtcgtggcagaagtgacacagccatccttgggtgtaggctatgagctgggccgggccgtggcctttaacaagcggatcctgtgcctgttccgcccgcagtctggccgcgtgctttcggccatgatccggggagcagcagatggctctcggttccaggtgtgggactatgaggagggagaggtggaggccctgctggatcgatacttcgaggctgatcctccagggcaggtggctgcctcccctgacccaaccacttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 1 open reading frame 159 - solute carrier family 25, member 26 - chromosome 20 open reading frame 26 - chromosome 19 open reading frame 60 |