PLDN-pallidin homolog (mouse) Gene

View larger

PLDN-pallidin homolog (mouse) Gene

Reference: PTXBC004819

Condition: New product

Print

Data sheet of PLDN-pallidin homolog (mouse) Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about PLDN-pallidin homolog (mouse) Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC004819
Product type:	DNA & cDNA
Ncbi symbol:	PLDN
Origin species:	Human
Product name:	PLDN-pallidin homolog (mouse) Gene
Size:	2ug
Accessions:	BC004819
Gene id:	26258
Gene description:	pallidin homolog (mouse)
Synonyms:	PLDN; BLOS6; HPS9; PALLID; biogenesis of lysosome-related organelles complex 1 subunit 6; BLOC-1 subunit 6; biogenesis of lysosomal organelles complex-1, subunit 5, pallidin; biogenesis of lysosomal organelles complex-1, subunit 6, pallidin; pallid protein homolog; syntaxin 13 binding protein 1; syntaxin 13-interacting protein pallid; biogenesis of lysosomal organelles complex 1 subunit 6
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgagtgtccctgggccgtcgtctccggacggggccctgacacggccaccctactgcctggaggccggggagccgacgcctggtttaagtgacacttctccagatgaagggttaatagaggacttgactatagaagacaaagcagtggagcaactggcagaaggattgctttctcattatttgccagatctgcagagatcaaaacaagccctccaggaactcacacagaaccaagttgtattgttagacacactggaacaagagatttcaaaatttaaagaatgtcattctatgttggatattaatgctttgtttgctgaggctaaacactatcatgccaagttggtgaatataagaaaagagatgctgatgcttcatgaaaaaacatcaaagttaaaaaaaagagcacttaaactgcagcagaagaggcaaaaagaagagttggaaagggagcagcaacgagagaaggagtttgaaagagaaaagcagttaactgccagaccagccaaaaggatgtga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- ribosomal protein L18a - programmed cell death 6 - phosphomevalonate kinase - phospholipase C, beta 2

Reviews

Be the first to write your review !

Buy PLDN-pallidin homolog (mouse) Gene now