Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of MRCL3-myosin regulatory light chain MRCL3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRCL3-myosin regulatory light chain MRCL3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016372 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRCL3 |
| Origin species: | Human |
| Product name: | MRCL3-myosin regulatory light chain MRCL3 Gene |
| Size: | 2ug |
| Accessions: | BC016372 |
| Gene id: | 10627 |
| Gene description: | myosin regulatory light chain MRCL3 |
| Synonyms: | MRCL3; HEL-S-24; MLC-2B; MLCB; MRLC3; MYL2B; myosin regulatory light chain 12A; epididymis secretory protein Li 24; myosin RLC; myosin regulatory light chain 2, nonsarcomeric; myosin regulatory light chain 3; myosin regulatory light chain MRLC3; myosin, light chain 12A, regulatory, non-sarcomeric; myosin, light polypeptide, regulatory, non-sarcomeric (20kD); myosin light chain 12A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgagcaaaagaacaaagaccaagaccaagaagcgccctcagcgtgcaacatccaatgtgtttgctatgtttgaccagtcacagattcaggagttcaaagaggccttcaacatgattgatcagaacagagatggtttcatcgacaaggaagatttgcatgatatgcttgcttcattggggaagaatccaactgatgagtatctagatgccatgatgaatgaggctccaggccccatcaatttcaccatgttcctcaccatgtttggtgagaagttaaatggcacagatcctgaagatgtcatcagaaatgcctttgcttgctttgatgaagaagcaactggcaccatacaggaagattacttgagagagctgctgacaaccatgggggatcggtttacagatgaggaagtggatgagctgtacagagaagcacctattgataaaaaggggaatttcaattacatcgagttcacacgcatcctgaaacatggagccaaagacaaagatgactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - regulator of G-protein signaling 10 - microfibrillar-associated protein 2 - islet cell autoantigen 1,69kDa-like - cysteine and glycine-rich protein 2 |