Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of PYCR1-pyrroline-5-carboxylate reductase 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PYCR1-pyrroline-5-carboxylate reductase 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022244 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PYCR1 |
| Origin species: | Human |
| Product name: | PYCR1-pyrroline-5-carboxylate reductase 1 Gene |
| Size: | 2ug |
| Accessions: | BC022244 |
| Gene id: | 5831 |
| Gene description: | pyrroline-5-carboxylate reductase 1 |
| Synonyms: | ARCL2B; ARCL3B; P5C; P5CR; PIG45; PP222; PRO3; PYCR; pyrroline-5-carboxylate reductase 1, mitochondrial; P5C reductase 1; proliferation-inducing protein 45; pyrroline-5-carboxylate reductase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagcagctgctgagcagcgtgggcttctgcacggaggtggaagaggacctgattgatgccgtcacggggctcagtggcagcggccccgcctacgcattcacagccctggatgccctggctgatgggggtgtgaagatgggacttccaaggcgcctggcagtccgcctcggggcccaggccctcctgggggctgccaagatgctgctgcactcagaacagcacccaggccagctcaaggacaacgtcagctctcctggtggggccaccatccatgccttgcatgtgctggagagtgggggcttccgctccctgctcatcaacgctgtggaggcctcctgcatccgcacacgggagctgcagtccatggctgaccaggagcaggtgtcaccagccgccatcaagaagaccatcctggacaaggtgaagctggactcccctgcagggaccgctctgtcgccttctggccacaccaagctgctcccccgcagcctggccccagcgggcaaggattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - myosin regulatory light chain MRCL3 - regulator of G-protein signaling 10 - microfibrillar-associated protein 2 - islet cell autoantigen 1,69kDa-like |