> >>ZG16-zymogen granule protein 16 Gene
ZG16-zymogen granule protein 16 Gene View larger

ZG16-zymogen granule protein 16 Gene

PTXBC029149

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language
Rate it

Data sheet of ZG16-zymogen granule protein 16 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZG16-zymogen granule protein 16 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029149
Product type: DNA & cDNA
Ncbi symbol: ZG16
Origin species: Human
Product name: ZG16-zymogen granule protein 16 Gene
Size: 2ug
Accessions: BC029149
Gene id: 123887
Gene description: zymogen granule protein 16
Synonyms: secretory lectin ZG16; JCLN; JCLN1; ZG16A; zymogen granule membrane protein 16; jacalin-like lectin domain containing; zymogen granule protein 16 homolog; zymogen granule protein 16
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttgacagtcgctctcctagcccttctctgtgcctcagcctctggcaatgccattcaggccaggtcttcctcctatagtggagagtatggaagtggtggtggaaagcgattctctcattctggcaaccagttggacggccccatcaccgccctccgggtccgagtcaacacatactacatcgtaggtcttcaggtgcgctatggcaaggtgtggagcgactatgtgggtggtcgcaacggagacctggaggagatctttctgcaccctggggaatcagtgatccaggtttctgggaagtacaagtggtacctgaagaagctggtatttgtgacagacaagggccgctatctgtcttttgggaaagacagtggcacaagtttcaatgccgtccccttgcaccccaacaccgtgctccgcttcatcagtggccggtctggttctctcatcgatgccattggcctgcactgggatgtttaccccactagctgcagcagatgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ferritin, light polypeptide
- ferritin, light polypeptide
- COMM domain containing 8
- RWD domain containing 4A

Reviews

Buy ZG16-zymogen granule protein 16 Gene now

Add to cart