AP1S3-adaptor-related protein complex 1, sigma 3 subunit Gene View larger

AP1S3-adaptor-related protein complex 1, sigma 3 subunit Gene

PTXBC009606

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AP1S3-adaptor-related protein complex 1, sigma 3 subunit Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about AP1S3-adaptor-related protein complex 1, sigma 3 subunit Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009606
Product type: DNA & cDNA
Ncbi symbol: AP1S3
Origin species: Human
Product name: AP1S3-adaptor-related protein complex 1, sigma 3 subunit Gene
Size: 2ug
Accessions: BC009606
Gene id: 130340
Gene description: adaptor-related protein complex 1, sigma 3 subunit
Synonyms: PSORS15; AP-1 complex subunit sigma-3; adapter-related protein complex 1 subunit sigma-1C; adaptor protein complex AP-1 sigma-1C subunit; adaptor-related protein complex 1 subunit sigma-1C; clathrin assembly protein complex 1 sigma-1C small chain; golgi adaptor HA1/AP1 adaptin sigma-1C subunit; sigma 1C subunit of AP-1 clathrin; adaptor related protein complex 1 sigma 3 subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatacatttcatattgctcttcagtcgacaagggaaattacggctacagaaatggtacatcactctccctgataaagagaggaagaagatcacccgggaaattgttcagattattctctcccgtggtcacaggacaagcagttttgttgactggaaggagctaaaacttgtttataaaaggtatgctagtttatatttttgctgtgcaatagaaaatcaggacaatgagctcttgacgctagagattgtgcatcgttacgtggagctgctggacaaatattttggaaatgtctgtgagctggatattatctttaattttgaaaaggcttatttcatcctggacgagtttataataggtggggaaattcaggaaacatccaagaaaattgctgtcaaagccattgaagactctgatatgttacaggagaatcgtttgagccccagaggcagagattgcagtgagccgagatcatgccattgcactctagcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - centrin, EF-hand protein, 3 (CDC31 homolog, yeast)
- CCHC-type zinc finger, nucleic acid binding protein
- CKLF-like MARVEL transmembrane domain containing 7
- chromobox homolog 5 (HP1 alpha homolog, Drosophila)

Reviews

Buy AP1S3-adaptor-related protein complex 1, sigma 3 subunit Gene now

Add to cart