Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
NUDT11-nudix (nucleoside diphosphate linked moiety X)-type motif 11 Gene
PTXBC009942
New product
Data sheet of NUDT11-nudix (nucleoside diphosphate linked moiety X)-type motif 11 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NUDT11-nudix (nucleoside diphosphate linked moiety X)-type motif 11 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009942 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NUDT11 |
| Origin species: | Human |
| Product name: | NUDT11-nudix (nucleoside diphosphate linked moiety X)-type motif 11 Gene |
| Size: | 2ug |
| Accessions: | BC009942 |
| Gene id: | 55190 |
| Gene description: | nudix (nucleoside diphosphate linked moiety X)-type motif 11 |
| Synonyms: | APS1; ASP1; DIPP3b; DIPP3beta; hDIPP3beta; diphosphoinositol polyphosphate phosphohydrolase 3-beta; DIPP-3-beta; DIPP3-beta; diadenosine 5',5'''-P1,P6-hexaphosphate hydrolase 3-beta; diadenosine hexaphosphate hydrolase (AMP-forming); diphosphoinositol polyphosphate phosphohydrolase 3, beta; hAps1; nucleoside diphosphate-linked moiety X motif 11; nudix (nucleoside diphosphate linked moiety X)-type motif 11; nudix motif 11; nudix hydrolase 11 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagtgcaaacccaaccagacgcggacctacgaccccgaggggttcaagaagcgggcggcgtgcctgtgcttccggagcgaacgcgaggacgaggtcctgttagtgagtagcagccggtacccggaccgctggatcgtgccgggcgggggcatggagcccgaggaggagccgggcggtgcggcggtccgagaggtgtacgaagaagcgggagtcaaggggaagttaggccggctcctgggcgtcttcgaacagaaccaggatcgcaagcacagaacgtacgtgtatgtactgactgtcacggagctgctggaggattgggaagattcggttagcattgggaggaagcgagagtggttcaaagtcgaagatgccatcaaggttctccagtgccacaagcccgtgcacgccgaatatctggagaaactaaagctgggcggttccccaaccaatggaaactccatggccccatcctcgccagatagcgatccctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nudix (nucleoside diphosphate linked moiety X)-type motif 22 - aldo-keto reductase family 1, member B10 (aldose reductase) - nudix (nucleoside diphosphate linked moiety X)-type motif 18 - aldo-keto reductase family 1, member A1 (aldehyde reductase) |