Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of C15orf15-chromosome 15 open reading frame 15 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C15orf15-chromosome 15 open reading frame 15 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008499 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C15orf15 |
| Origin species: | Human |
| Product name: | C15orf15-chromosome 15 open reading frame 15 Gene |
| Size: | 2ug |
| Accessions: | BC008499 |
| Gene id: | 51187 |
| Gene description: | chromosome 15 open reading frame 15 |
| Synonyms: | C15orf15; HRP-L30-iso; L30; RLP24; RPL24; RPL24L; TVAS3; 60S ribosomal protein L30 isolog; homolog of yeast ribosomal like protein 24; my024 protein; ribosomal L24 domain-containing protein 1; ribosomal L24 domain containing 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcgtatcgaaaagtgttatttctgttcggggcccatctatcctggacacggcatgatgttcgtccgcaacgattgcaaggtgatcagattttgcaaatctaaatgtcataaaaactttaaaaagaagcgcaatcctcgcaaagttaggtggaccaaagcattccggaaagcagctggtaaagagcttacagtggataattcatttgaatttgaaaaacgtagaaatgaacctatcaaataccagcgagagctatggaataaaactattgatgcgatgaagagagttgaagaaatcaaacagaagcgccaagctaaatttataatgaacagattgaagaaaaataaagagctacagaaagttcaggatatcaaagaagtcaagcaaaacatccatcttatccgagcccctcttgcaggcaaagggaaacagttggaagagaaaatggtacagcagttacaagaggatgtggacatggaagatgctccttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RAN guanine nucleotide release factor - RAN guanine nucleotide release factor - chromosome 18 open reading frame 10 - chromosome 19 open reading frame 10 |