Cart 1 Product Products 121,50 € (empty)
-
1 x RAB3IL1-RA...121,50 €
No products
To be determined Shipping
121,50 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 121,50 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 121,50 €
View larger 
Data sheet of ACAT1-acetyl-Coenzyme A acetyltransferase 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ACAT1-acetyl-Coenzyme A acetyltransferase 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010942 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ACAT1 |
| Origin species: | Human |
| Product name: | ACAT1-acetyl-Coenzyme A acetyltransferase 1 Gene |
| Size: | 2ug |
| Accessions: | BC010942 |
| Gene id: | 38 |
| Gene description: | acetyl-Coenzyme A acetyltransferase 1 |
| Synonyms: | ACAT; MAT; THIL; acetyl-CoA acetyltransferase, mitochondrial; acetoacetyl Coenzyme A thiolase; acetoacetyl-CoA thiolase; acetyl-Coenzyme A acetyltransferase 1; mitochondrial acetoacetyl-CoA thiolase; testicular tissue protein Li 198; acetyl-CoA acetyltransferase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgtgctgccggcacttctgcgcagcggcgcccgcagccgcagccccctgctccggaggctggtgcaggaaataagatatgtggaacggagttatgtatcaaaacccactttgaaggaagtggtcatagtaagtgctacaagaacacccattggatcttttttaggcagcctttccttgctgccagccactaagcttggttccattgcaattcagggagccattgaaaaggcagggattccaaaagaagaagtgaaagaagcatacatgggtaatgttctacaaggaggtgaaggacaagctcctacaaggcaggcagtattgggtgcaggcttacctatttctactccatgtaccaccataaacaaagtttgtgcttcaggaatgaaagccatcatgatggcctctcaaagtcttatgtgtggacatcagatcaagcaagagacaggctccttagcaaaaatatgctgtcatgtcaggaggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - N-acetyltransferase 13 (GCN5-related) - intermediate filament family orphan 1 - GINS complex subunit 3 (Psf3 homolog) - GrpE-like 1, mitochondrial (E. coli) |