PMP22-peripheral myelin protein 22 Gene

View larger

PMP22-peripheral myelin protein 22 Gene

Reference: PTXBC019040

Condition: New product

Print

Data sheet of PMP22-peripheral myelin protein 22 Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about PMP22-peripheral myelin protein 22 Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC019040
Product type:	DNA & cDNA
Ncbi symbol:	PMP22
Origin species:	Human
Product name:	PMP22-peripheral myelin protein 22 Gene
Size:	2ug
Accessions:	BC019040
Gene id:	5376
Gene description:	peripheral myelin protein 22
Synonyms:	CMT1A; CMT1E; DSS; GAS-3; GAS3; HMSNIA; HNPP; Sp110; peripheral myelin protein 22; growth arrest-specific protein 3; peripheral myelin protein 22 kDa
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgctcctcctgttgctgagtatcatcgtcctccacgtcgcggtgctggtgctgctgttcgtctccacgatcgtcagccaatggatcgtgggcaatggacacgcaactgatctctggcagaactgtagcacctcttcctcaggaaatgtccaccactgtttctcatcatcaccaaacgaatggctgcagtctgtccaggccaccatgatcctgtcgatcatcttcagcattctgtctctgttcctgttcttctgccaactcttcaccctcaccaaggggggcaggttttacatcactggaatcttccaaattcttgctggtctgtgcgtgatgagtgctgcggccatctacacggtgaggcacccggagtggcatctcaactcggattactcctacggtttcgcctacatcctggcctgggtggccttccccctggcccttctcagcggtgtcatctatgtgatcttgcggaaacgcgaatga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- serine/threonine kinase 32A - RNA binding motif protein 8A - ferritin, heavy polypeptide 1 - sperm associated antigen 16

Reviews

Be the first to write your review !

Buy PMP22-peripheral myelin protein 22 Gene now