Cart 3 Product Products 318,96 € (empty)
-
-
-
1 x CRYGD-crys...113,40 €
No products
To be determined Shipping
318,96 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 3 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 318,96 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 318,96 €
Data sheet of SKP1-S-phase kinase-associated protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SKP1-S-phase kinase-associated protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC025673 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SKP1 |
| Origin species: | Human |
| Product name: | SKP1-S-phase kinase-associated protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC025673 |
| Gene id: | 6500 |
| Gene description: | S-phase kinase-associated protein 1 |
| Synonyms: | EMC19; OCP-II; OCP2; SKP1A; TCEB1L; p19A; S-phase kinase-associated protein 1; OCP-2; RNA polymerase II elongation factor-like protein OCP2; SIII; cyclin A/CDK2-associated p19; cyclin-A/CDK2-associated protein p19; organ of Corti protein 2; organ of Corti protein II; p19skp1; transcription elongation factor B polypeptide 1-like; S-phase kinase associated protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccttcaattaagttgcagagttctgatggagagatatttgaagttgatgtggaaattgccaaacaatctgtgactattaagaccatgttggaagatttgggaatggatgatgaaggagatgatgacccagttcctctaccaaatgtgaatgcagcaatattaaaaaaggtcattcagtggtgcacccaccacaaggatgaccctcctcctcctgaagatgatgagaacaaagaaaagcgaacagatgatatccctgtttgggaccaagaattcctgaaagttgaccaaggaacactttttgaactcattctggctgcaaactacttagacatcaaaggtttgcttgatgttacatgcaagactgttgccaatatgatcaaggggaaaactcctgaggagattcgcaagaccttcaatatcaaaaatgactttactgaagaggaggaagcccaggtaggtagcacacagttttgtctttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cold inducible RNA binding protein - troponin I type 1 (skeletal, slow) - chromosome 2 open reading frame 7 - BH3 interacting domain death agonist |