No products
Prices are tax excluded
PTXBC025673
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC025673 |
Product type: | DNA & cDNA |
Ncbi symbol: | SKP1 |
Origin species: | Human |
Product name: | SKP1-S-phase kinase-associated protein 1 Gene |
Size: | 2ug |
Accessions: | BC025673 |
Gene id: | 6500 |
Gene description: | S-phase kinase-associated protein 1 |
Synonyms: | EMC19; OCP-II; OCP2; SKP1A; TCEB1L; p19A; S-phase kinase-associated protein 1; OCP-2; RNA polymerase II elongation factor-like protein OCP2; SIII; cyclin A/CDK2-associated p19; cyclin-A/CDK2-associated protein p19; organ of Corti protein 2; organ of Corti protein II; p19skp1; transcription elongation factor B polypeptide 1-like; S-phase kinase associated protein 1 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgccttcaattaagttgcagagttctgatggagagatatttgaagttgatgtggaaattgccaaacaatctgtgactattaagaccatgttggaagatttgggaatggatgatgaaggagatgatgacccagttcctctaccaaatgtgaatgcagcaatattaaaaaaggtcattcagtggtgcacccaccacaaggatgaccctcctcctcctgaagatgatgagaacaaagaaaagcgaacagatgatatccctgtttgggaccaagaattcctgaaagttgaccaaggaacactttttgaactcattctggctgcaaactacttagacatcaaaggtttgcttgatgttacatgcaagactgttgccaatatgatcaaggggaaaactcctgaggagattcgcaagaccttcaatatcaaaaatgactttactgaagaggaggaagcccaggtaggtagcacacagttttgtctttga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - cold inducible RNA binding protein - troponin I type 1 (skeletal, slow) - chromosome 2 open reading frame 7 - BH3 interacting domain death agonist |