SCAMP1-secretory carrier membrane protein 1 Gene

View larger

SCAMP1-secretory carrier membrane protein 1 Gene

Reference: PTXBC009787

Condition: New product

Print

Data sheet of SCAMP1-secretory carrier membrane protein 1 Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about SCAMP1-secretory carrier membrane protein 1 Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC009787
Product type:	DNA & cDNA
Ncbi symbol:	SCAMP1
Origin species:	Human
Product name:	SCAMP1-secretory carrier membrane protein 1 Gene
Size:	2ug
Accessions:	BC009787
Gene id:	9522
Gene description:	secretory carrier membrane protein 1
Synonyms:	SCAMP; SCAMP37; secretory carrier-associated membrane protein 1; secretory carrier membrane protein 1
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgtcggatttcgacagtaacccgtttgccgacccggatctcaacaatcccttcaaggatccatcagttacacaagtgacaagaaatgttccaccaggacttgatgaatataatccattctcggattctagaacacctccaccaggcggtgtgaagatgcctaatgtacccaatacacaaccagcaataatgaaaccaacagaggaacatccagcttatacacagattgcaaaggaacatgcattggcccaagctgaacttcttaagcgccaggaagaactagaaagaaaagccgcagaattagatcgtcgggaacgagaaatgcaaaacctcagtcaacatggtagaaaaaataattggccacctcttcctagcaattttcctgtcggaccttgtttctatcaggatttttctgtagacattcctgtagaattccaaaagacagtaaagcttatgtactacttgtggatgtga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- acetyl-Coenzyme A acetyltransferase 1 - N-acetyltransferase 13 (GCN5-related) - intermediate filament family orphan 1 - GINS complex subunit 3 (Psf3 homolog)

Reviews

Be the first to write your review !

Buy SCAMP1-secretory carrier membrane protein 1 Gene now