Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of RNASE1-ribonuclease, RNase A family, 1 (pancreatic) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RNASE1-ribonuclease, RNase A family, 1 (pancreatic) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005324 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RNASE1 |
| Origin species: | Human |
| Product name: | RNASE1-ribonuclease, RNase A family, 1 (pancreatic) Gene |
| Size: | 2ug |
| Accessions: | BC005324 |
| Gene id: | 6035 |
| Gene description: | ribonuclease, RNase A family, 1 (pancreatic) |
| Synonyms: | RAC1; RIB1; RNS1; ribonuclease pancreatic; HP-RNase; RIB-1; RNase 1; RNase A; RNase upI-1; ribonuclease 1; ribonuclease A C1; ribonuclease, RNase A family, 1 (pancreatic); ribonuclease A family member 1, pancreatic |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctctggagaagtctcttgtccggctccttctgcttgtcctgatactgctggtgctgggctgggtccagccttccctgggcaaggaatcccgggccaagaaattccagcggcagcatatggactcagacagttcccccagcagcagctccacctactgtaaccaaatgatgaggcgccggaatatgacacaggggcggtgcaaaccagtgaacacctttgtgcacgagcccctggtagatgtccagaatgtctgtttccaggaaaaggtcacctgcaagaacgggcagggcaactgctacaagagcaactccagcatgcacatcacagactgccgcctgacaaacggctccaggtaccccaactgtgcataccggaccagcccgaaggagagacacatcattgtggcctgtgaagggagcccatatgtgccagtccactttgatgcttctgtggaggactctacctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - neuroblastoma, suppression of tumorigenicity 1 - family with sequence similarity 98, member C - MAD2 mitotic arrest deficient-like 2 (yeast) - family with sequence similarity 54, member A |