Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CAPN3-calpain 3, (p94) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CAPN3-calpain 3, (p94) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003521 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CAPN3 |
| Origin species: | Human |
| Product name: | CAPN3-calpain 3, (p94) Gene |
| Size: | 2ug |
| Accessions: | BC003521 |
| Gene id: | 825 |
| Gene description: | calpain 3, (p94) |
| Synonyms: | CANP3; CANPL3; LGMD2; LGMD2A; nCL-1; p94; calpain-3; calpain p94, large [catalytic] subunit; calpain, large polypeptide L3; muscle-specific calcium-activated neutral protease 3 large subunit; new calpain 1; calpain 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagatctgtgcagatgagctcaagaaggtccttaacacagtcgtgaacaaacacaaggacctgaagacacacgggttcacactggagtcctgccgtagcatgattgcgctcatggatacagatggctctggaaagctcaacctgcaggagttccaccacctctggaacaagattaaggcctggcagaaaattttcaaacactatgacacagaccagtccggcaccatcaacagctacgagatgcgaaatgcagtcaacgacgcaggattccacctcaacaaccagctctatgacatcattaccatgcggtacgcagacaaacacatgaacatcgactttgacagtttcatctgctgcttcgttaggctggagggcatgttcagagcttttcatgcatttgacaaggatggagatggtatcatcaagctcaacgttctggagtggctgcagctcaccatgtatgcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - sorting nexin 12 - lysozyme G-like 1 - MARCKS-like 1 - docking protein 5 |