Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ATP6V0C-ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c Gene
PTXBC004537
New product
Data sheet of ATP6V0C-ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ATP6V0C-ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004537 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ATP6V0C |
| Origin species: | Human |
| Product name: | ATP6V0C-ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c Gene |
| Size: | 2ug |
| Accessions: | BC004537 |
| Gene id: | 527 |
| Gene description: | ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c |
| Synonyms: | ATP6C; ATP6L; ATPL; VATL; VPPC; Vma3; V-type proton ATPase 16 kDa proteolipid subunit; ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c; H(+)-transporting two-sector ATPase, 16 kDa subunit; V-ATPase 16 kDa proteolipid subunit; vacuolar ATP synthase 16 kDa proteolipid subunit; vacuolar H+ ATPase proton channel subunit; vacuolar proton pump 16 kDa proteolipid subunit; ATPase H+ transporting V0 subunit c |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccgagtccaagagcggccccgagtatgcttcgtttttcgccgtcatgggcgcctcggccgccatggtcttcagcgccctgggcgctgcctatggcacagccaagagcggtaccggcattgcggccatgtctgtcatgcggccggagcagatcatgaagtccatcatcccagtggtcatggctggcatcatcgccatctacggcctggtggtggcagtcctcatcgccaactccctgaatgacgacatcagcctctacaagagcttcctccagctgggcgccggcctgagcgtgggcctgagcggcctggcagccggctttgccatcggcatcgtgggggacgctggcgtgcggggcaccgcccagcagccccgactattcgtgggcatgatcctgattctcatcttcgccgaggtgctcggcctctacggtctcatcgtcgccctcatcctctccacaaagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c - transmembrane emp24-like trafficking protein 10 (yeast) - coiled-coil-helix-coiled-coil-helix domain containing 3 - major histocompatibility complex, class II, DQ beta 2 |