ATP6V0C-ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c Gene View larger

ATP6V0C-ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c Gene

PTXBC004537

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ATP6V0C-ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ATP6V0C-ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004537
Product type: DNA & cDNA
Ncbi symbol: ATP6V0C
Origin species: Human
Product name: ATP6V0C-ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c Gene
Size: 2ug
Accessions: BC004537
Gene id: 527
Gene description: ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c
Synonyms: ATP6C; ATP6L; ATPL; VATL; VPPC; Vma3; V-type proton ATPase 16 kDa proteolipid subunit; ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c; H(+)-transporting two-sector ATPase, 16 kDa subunit; V-ATPase 16 kDa proteolipid subunit; vacuolar ATP synthase 16 kDa proteolipid subunit; vacuolar H+ ATPase proton channel subunit; vacuolar proton pump 16 kDa proteolipid subunit; ATPase H+ transporting V0 subunit c
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccgagtccaagagcggccccgagtatgcttcgtttttcgccgtcatgggcgcctcggccgccatggtcttcagcgccctgggcgctgcctatggcacagccaagagcggtaccggcattgcggccatgtctgtcatgcggccggagcagatcatgaagtccatcatcccagtggtcatggctggcatcatcgccatctacggcctggtggtggcagtcctcatcgccaactccctgaatgacgacatcagcctctacaagagcttcctccagctgggcgccggcctgagcgtgggcctgagcggcctggcagccggctttgccatcggcatcgtgggggacgctggcgtgcggggcaccgcccagcagccccgactattcgtgggcatgatcctgattctcatcttcgccgaggtgctcggcctctacggtctcatcgtcgccctcatcctctccacaaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c
- transmembrane emp24-like trafficking protein 10 (yeast)
- coiled-coil-helix-coiled-coil-helix domain containing 3
- major histocompatibility complex, class II, DQ beta 2

Reviews

Buy ATP6V0C-ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c Gene now

Add to cart