Cart 13 Product Products 1 970,95 € (empty)
-
-
1 x TGFB1-tran...121,50 € -
-
1 x TRAF4...259,07 € -
-
1 x MRPL36-mit...113,40 € -
-
1 x COX7A2L-cy...113,40 € -
1 x FAM83F-fam...121,50 € -
1 x PTDSS2-pho...121,50 € -
1 x STH-saitoh...113,40 € -
1 x OMG-oligod...121,50 € -
1 x Ret...259,07 €
No products
To be determined Shipping
1 970,95 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 13 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 970,95 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 970,95 €
Data sheet of KIAA1143-KIAA1143 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KIAA1143-KIAA1143 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008468 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KIAA1143 |
| Origin species: | Human |
| Product name: | KIAA1143-KIAA1143 Gene |
| Size: | 2ug |
| Accessions: | BC008468 |
| Gene id: | 57456 |
| Gene description: | KIAA1143 |
| Synonyms: | uncharacterized protein KIAA1143 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagcaagcggaaccaggtatcgtacgtgcggccagccgagccggcgtttctggcccgcttcaaggaacgggtcggctacagggagggacccaccgtagagactaagagaattcagcctcagcccccagatgaagatggggatcacagtgacaaagaagatgaacagcctcaagtggtggttttaaaaaagggagacctgtcagttgaagaagtcatgaaaattaaagcagaaataaaggctgccaaagcagatgaagaaccaactccagccgatggaagaatcatatatcgaaaaccagtcaagcatccctcagatgaaaaatattcaggtttaacagcaagctcaaaaaagaagaagccaaatgaagatgaagtaaatcaggactcggtcaaaaagaactcacaaaaacaaattaaaaatagtagcctcctttcttttgacaacgaagatgaaaatgagtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - complexin 3 - ATP5S-like - endothelin 2 - SAP30-like |