MGST3-microsomal glutathione S-transferase 3 Gene View larger

MGST3-microsomal glutathione S-transferase 3 Gene

PTXBC005964

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGST3-microsomal glutathione S-transferase 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MGST3-microsomal glutathione S-transferase 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005964
Product type: DNA & cDNA
Ncbi symbol: MGST3
Origin species: Human
Product name: MGST3-microsomal glutathione S-transferase 3 Gene
Size: 2ug
Accessions: BC005964
Gene id: 4259
Gene description: microsomal glutathione S-transferase 3
Synonyms: GST-III; microsomal glutathione S-transferase 3; microsomal GST-3; microsomal GST-III; microsomal glutathione S-transferase III
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgtcctctctaaggaatatggttttgtgcttctaactggtgctgccagctttataatggtggcccacctagccatcaatgtttccaaggcccgcaagaagtacaaagtggagtatcctatcatgtacagcacggaccctgaaaatgggcacatcttcaactgcattcagcgagcccaccagaacacgttggaagtgtatcctcccttcttattttttctagctgttggaggtgtttaccacccgcgtatagcttctggcctgggcttggcctggattgttggacgagttctttatgcttacggctattacacgggagaacccagcaagcgtagtcgaggagccctggggtccatcgccctcctgggcttggtgggcacaactgtgtgctctgctttccagcatcttggttgggttaaaagtggcttgggcagtggacccaaatgctgccattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 15 open reading frame 15
- chromosome 15 open reading frame 15
- chromosome 15 open reading frame 15
- RAN guanine nucleotide release factor

Reviews

Buy MGST3-microsomal glutathione S-transferase 3 Gene now

Add to cart