Cart 33 Product Products 4 711,10 € (empty)
-
-
1 x TGFB1-tran...121,50 € -
-
1 x TRAF4...259,07 € -
-
1 x MRPL36-mit...113,40 € -
-
1 x COX7A2L-cy...113,40 € -
1 x FAM83F-fam...121,50 € -
1 x PTDSS2-pho...121,50 € -
1 x STH-saitoh...113,40 € -
1 x OMG-oligod...121,50 € -
1 x Ret...259,07 € -
1 x C2orf53-ch...121,50 € -
1 x CD320-CD32...121,50 € -
-
1 x C15orf23-c...121,50 € -
1 x ATP1B1-ATP...121,50 € -
1 x JMJD7-jumo...121,50 € -
1 x LHR...259,07 € -
-
-
-
1 x FAM122B-fa...113,40 € -
1 x RUVBL2-Ruv...113,40 € -
1 x C6orf123-c...113,40 € -
1 x C19orf39-c...113,40 € -
1 x CAPZB-capp...121,50 € -
-
1 x TMEM126B-t...113,40 € -
1 x TULP1-tubb...121,50 € -
1 x NCALD-neur...113,40 € -
No products
To be determined Shipping
4 711,10 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 33 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 711,10 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 711,10 €
Data sheet of GYPA-glycophorin A (MNS blood group) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GYPA-glycophorin A (MNS blood group) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013328 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GYPA |
| Origin species: | Human |
| Product name: | GYPA-glycophorin A (MNS blood group) Gene |
| Size: | 2ug |
| Accessions: | BC013328 |
| Gene id: | 2993 |
| Gene description: | glycophorin A (MNS blood group) |
| Synonyms: | CD235a; GPA; GPErik; GPSAT; HGpMiV; HGpMiXI; HGpSta(C); MNS; PAS-2; glycophorin-A; MN sialoglycoprotein; Mi.V glycoprotein (24 AA); erythroid-lineage-specific membrane sialoglycoprotein; glycophorin A (MN blood group); glycophorin A, GPA; glycophorin Erik; glycophorin MiI; glycophorin MiV; glycophorin SAT; glycophorin Sta type C; recombinant glycophorin A-B Miltenberger-DR; sialoglycoprotein alpha; glycophorin A (MNS blood group) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtatggaaaaataatctttgtattactattgtcagcaattgtgagcatatcagcatcaagtaccactggtgtggcaatgcacacttcaacctcttcttcagtcacaaagagttacatctcatcacagacaaatgatacgcacaaacgggacacatatgcagccactcctagagctcatgaagtttcagaaatttctgttagaactgtttaccctccagaagaggaaaccggagaaagggtacaacttgcccatcatttctctgaaccagagataacactcattatttttggggtgatggctggtgttattggaacgatcctcttaatttcttacggtattcgccgactgataaagaaaagcccatctgatgtaaaacctctcccctcacctgacacagacgtgcctttaagttctgttgaaatagaaaatccagagacaagtgatcaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - glycophorin A (MNS blood group) - natriuretic peptide precursor A - hypothetical protein MGC12972 - methylphosphate capping enzyme |