RPL27A-ribosomal protein L27a Gene

View larger

RPL27A-ribosomal protein L27a Gene

Reference: PTXBC005326

Condition: New product

Print

Data sheet of RPL27A-ribosomal protein L27a Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about RPL27A-ribosomal protein L27a Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC005326
Product type:	DNA & cDNA
Ncbi symbol:	RPL27A
Origin species:	Human
Product name:	RPL27A-ribosomal protein L27a Gene
Size:	2ug
Accessions:	BC005326
Gene id:	6157
Gene description:	ribosomal protein L27a
Synonyms:	L27A; 60S ribosomal protein L27a; ribosomal protein L27a
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgccatccagactgaggaagacccggaaacttaggggccacgtgagccacggccacggccgcataggcaagcaccggaagcaccccggcggccgcggtaatgctggtggtctgcatcaccaccggatcaacttcgacaaataccacccaggctactttgggaaagttggtatgaagcattaccacttaaagaggaaccagagcttctgcccaactgtcaaccttgacaaattgtggactttggtcagtgaacagacacgggtgaatgctgctaaaaacaagactggggctgctcccatcattgatgtggtgcgatcgggctactacaaagttctgggaaagggaaagctcccaaagcagcctgtcatcgtgaaggccaaattcttcagcagaagagctgaggagaagattaagagtgttgggggggcctgtgtcctggtggcttga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- gastrin-releasing peptide - pallidin homolog (mouse) - ribosomal protein L18a - programmed cell death 6

Reviews

Be the first to write your review !

Buy RPL27A-ribosomal protein L27a Gene now