Cart 11 Product Products 1 443,51 € (empty)
-
1 x DLX3-dista...121,50 € -
1 x KIAA0895L-...121,50 € -
1 x C1D-nuclea...113,40 € -
1 x MLF1IP-MLF...121,50 € -
1 x RPL36AL-ri...113,40 € -
1 x SLC7A6OS-s...121,50 € -
1 x CHST6...259,07 € -
1 x LEP-leptin...113,40 € -
1 x TECTB-tect...121,50 € -
1 x GAL3ST3-ga...121,50 € -
No products
To be determined Shipping
1 443,51 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 11 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 443,51 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 443,51 €
View larger 
Data sheet of PAGE1-P antigen family, member 1 (prostate associated) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PAGE1-P antigen family, member 1 (prostate associated) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004861 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PAGE1 |
| Origin species: | Human |
| Product name: | PAGE1-P antigen family, member 1 (prostate associated) Gene |
| Size: | 2ug |
| Accessions: | BC004861 |
| Gene id: | 8712 |
| Gene description: | P antigen family, member 1 (prostate associated) |
| Synonyms: | AL5; CT16.3; GAGE-9; GAGEB1; PAGE-1; P antigen family member 1; G antigen 9; G antigen family B member 1; G antigen, family B, 1 (prostate associated); P antigen family, member 1 (prostate associated); prostate associated gene 1; prostate-associated gene 1 protein; PAGE family member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggttttctaagaagattaatctatcggcgtagaccaatgatctatgtagaatcttctgaggagtccagtgatgagcaacctgacgaagtggaatcaccaactcaaagtcaggattctacacctgctgaagagagagaggatgagggagcatctgcagctcaagggcaggagcctgaagctgatagccaggaactggttcagccaaagactgggtgtgagcttggagatggtcctgataccaagagggtgtgcctgcgaaatgaagagcagatgaaactgcccgcagaagggccagagcctgaagcggatagccaggaacaggttcacccgaagactgggtgtgagcgcggagatggtcctgatgtccaggagttgggcctgccaaatccagaggaggtgaaaacacctgaggaagatgaagggcaatcacagccttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - FXYD domain containing ion transport regulator 5 - linker for activation of T cells family, member 2 - protein kinase, cAMP-dependent, catalytic, beta - ATPase, Na+/K+ transporting, beta 3 polypeptide |